Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008380500:

Variant ID: vg1008380500 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8380500
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAACCCTAGATAATCATATATGCTATTTCTAATTACAAATCTAATAATATTATATTAAAACTCAAATAATCTTGTATTAAAACTCTAATAATCTTATA[T/A]
TAAAAATCTAATAGTCATATATGCTAAGTCTAAGTGTCGTATATTAGAACCCTAGATAATCATATATGCTAAGTCTAATTACAAATCTAATAATCTTATA

Reverse complement sequence

TATAAGATTATTAGATTTGTAATTAGACTTAGCATATATGATTATCTAGGGTTCTAATATACGACACTTAGACTTAGCATATATGACTATTAGATTTTTA[A/T]
TATAAGATTATTAGAGTTTTAATACAAGATTATTTGAGTTTTAATATAATATTATTAGATTTGTAATTAGAAATAGCATATATGATTATCTAGGGTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	0.20%	8.46%	19.87%	NA
All Indica	2759	63.40%	0.00%	3.41%	33.20%	NA
All Japonica	1512	98.00%	0.10%	1.52%	0.33%	NA
Aus	269	4.50%	2.20%	92.19%	1.12%	NA
Indica I	595	86.40%	0.00%	3.87%	9.75%	NA
Indica II	465	43.00%	0.00%	0.86%	56.13%	NA
Indica III	913	64.50%	0.00%	2.74%	32.75%	NA
Indica Intermediate	786	56.70%	0.00%	5.34%	37.91%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	96.00%	0.20%	3.77%	0.00%	NA
Japonica Intermediate	241	97.10%	0.40%	1.24%	1.24%	NA
VI/Aromatic	96	70.80%	2.10%	26.04%	1.04%	NA
Intermediate	90	72.20%	1.10%	11.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008380500	T -> A	LOC_Os10g16810.1	upstream_gene_variant ; 2819.0bp to feature; MODIFIER	silent_mutation	Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg1008380500	T -> A	LOC_Os10g16824.1	intron_variant ; MODIFIER	silent_mutation	Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg1008380500	T -> DEL	N	N	silent_mutation	Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008380500	6.19E-06	6.18E-06	mr1025	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	3.25E-08	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	2.14E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	8.01E-08	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	1.43E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	3.10E-06	mr1394	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	9.70E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	8.19E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	4.62E-06	4.61E-06	mr1459	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	1.14E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	1.49E-06	NA	mr1584	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	2.69E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	7.42E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	4.92E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	2.94E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	7.47E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500	NA	1.75E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251