| Variant ID: vg1008172373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8172373 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCAGATCATGATATTTATAATTCATGGCTCTTTGATATGTAGCTCCAGCACTTTTCAAGCCAAAAGTCATTACGACCCACTCAAACAAGCCGATTGCAC[C/T]
AGGACACCTAAAAGCTGTCTTATGTATATCCTCTTCGGCCATGAAGATCTAATTGTAACCTACATTACCATCCATGAAACTTAATATCTTATATCCTGAA
TTCAGGATATAAGATATTAAGTTTCATGGATGGTAATGTAGGTTACAATTAGATCTTCATGGCCGAAGAGGATATACATAAGACAGCTTTTAGGTGTCCT[G/A]
GTGCAATCGGCTTGTTTGAGTGGGTCGTAATGACTTTTGGCTTGAAAAGTGCTGGAGCTACATATCAAAGAGCCATGAATTATAAATATCATGATCTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 5.50% | 2.64% | 27.30% | NA |
| All Indica | 2759 | 74.20% | 0.10% | 1.38% | 24.32% | NA |
| All Japonica | 1512 | 53.00% | 14.40% | 2.98% | 29.56% | NA |
| Aus | 269 | 29.00% | 0.00% | 14.50% | 56.51% | NA |
| Indica I | 595 | 97.30% | 0.00% | 0.00% | 2.69% | NA |
| Indica II | 465 | 78.30% | 0.40% | 0.65% | 20.65% | NA |
| Indica III | 913 | 55.50% | 0.00% | 2.63% | 41.84% | NA |
| Indica Intermediate | 786 | 75.80% | 0.30% | 1.40% | 22.52% | NA |
| Temperate Japonica | 767 | 39.20% | 17.20% | 2.09% | 41.46% | NA |
| Tropical Japonica | 504 | 71.20% | 9.70% | 4.17% | 14.88% | NA |
| Japonica Intermediate | 241 | 58.90% | 15.40% | 3.32% | 22.41% | NA |
| VI/Aromatic | 96 | 60.40% | 35.40% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 4.40% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008172373 | C -> T | LOC_Os10g16400.1 | downstream_gene_variant ; 2853.0bp to feature; MODIFIER | silent_mutation | Average:23.453; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1008172373 | C -> T | LOC_Os10g16390.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.453; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1008172373 | C -> DEL | N | N | silent_mutation | Average:23.453; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008172373 | 3.26E-06 | 3.26E-06 | mr1806 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008172373 | NA | 5.22E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008172373 | NA | 4.62E-10 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008172373 | NA | 3.34E-11 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008172373 | NA | 2.80E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |