Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007756406:

Variant ID: vg1007756406 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7756406
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.06, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGGTCGGTCGACAGCTCCCGGCGACGATGCAGGTGGAGCGGCCGGCGGCTCCCATCGATTCGGCGGCTGCCACTAATGGAGAAACCATTTTTGCCCG[A/G]
TCGACAAAAAGCACAATAGTCTCGGATACAATAAAAACCGAGACTAAAAATGGTTTTTAGTCCCAGTTTATAAGTAGAATGGGACTACGTGATCTTTAGT

Reverse complement sequence

ACTAAAGATCACGTAGTCCCATTCTACTTATAAACTGGGACTAAAAACCATTTTTAGTCTCGGTTTTTATTGTATCCGAGACTATTGTGCTTTTTGTCGA[T/C]
CGGGCAAAAATGGTTTCTCCATTAGTGGCAGCCGCCGAATCGATGGGAGCCGCCGGCCGCTCCACCTGCATCGTCGCCGGGAGCTGTCGACCGACCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	16.80%	0.80%	0.00%	NA
All Indica	2759	91.50%	7.10%	1.38%	0.00%	NA
All Japonica	1512	61.70%	38.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.30%	0.30%	1.34%	0.00%	NA
Indica II	465	75.70%	21.90%	2.37%	0.00%	NA
Indica III	913	93.60%	6.00%	0.33%	0.00%	NA
Indica Intermediate	786	93.10%	4.80%	2.04%	0.00%	NA
Temperate Japonica	767	46.70%	53.30%	0.00%	0.00%	NA
Tropical Japonica	504	91.90%	8.10%	0.00%	0.00%	NA
Japonica Intermediate	241	46.50%	53.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007756406	A -> G	LOC_Os10g14795.1	upstream_gene_variant ; 2461.0bp to feature; MODIFIER	silent_mutation	Average:53.478; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1007756406	A -> G	LOC_Os10g14800.1	upstream_gene_variant ; 1012.0bp to feature; MODIFIER	silent_mutation	Average:53.478; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1007756406	A -> G	LOC_Os10g14814.1	downstream_gene_variant ; 4718.0bp to feature; MODIFIER	silent_mutation	Average:53.478; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1007756406	A -> G	LOC_Os10g14795-LOC_Os10g14800	intergenic_region ; MODIFIER	silent_mutation	Average:53.478; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007756406	NA	9.13E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	NA	8.64E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	7.35E-07	7.30E-07	mr1197_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	NA	7.51E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	NA	2.64E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	4.65E-07	2.05E-26	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756406	NA	9.48E-09	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251