Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007581489:

Variant ID: vg1007581489 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7581489
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCATGGACCATGAAGTTGCATTTTTCCTAATTAAGTACCAAATCATTTTCTTAACACCGTTGCAAGACCATATCTAAATTTATGAGACAATAACAAAT[T/A]
TTTTTTCATAGACTGAGAAATCGTTCATGAAAACTTTCATGATTTCCTTGATCCTGTTGGGGAAGATAGATATCATAGACCTTTGGAATGACGCAAGTGT

Reverse complement sequence

ACACTTGCGTCATTCCAAAGGTCTATGATATCTATCTTCCCCAACAGGATCAAGGAAATCATGAAAGTTTTCATGAACGATTTCTCAGTCTATGAAAAAA[A/T]
ATTTGTTATTGTCTCATAAATTTAGATATGGTCTTGCAACGGTGTTAAGAAAATGATTTGGTACTTAATTAGGAAAAATGCAACTTCATGGTCCATGAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 49.00% 0.28% 0.00% NA
All Indica  2759 36.70% 62.80% 0.47% 0.00% NA
All Japonica  1512 83.70% 16.30% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 86.70% 12.80% 0.50% 0.00% NA
Indica II  465 16.80% 82.40% 0.86% 0.00% NA
Indica III  913 17.70% 82.10% 0.11% 0.00% NA
Indica Intermediate  786 32.70% 66.70% 0.64% 0.00% NA
Temperate Japonica  767 94.90% 5.10% 0.00% 0.00% NA
Tropical Japonica  504 72.60% 27.40% 0.00% 0.00% NA
Japonica Intermediate  241 71.40% 28.60% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007581489 T -> A LOC_Os10g13940.1 downstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:36.375; most accessible tissue: Callus, score: 69.666 N N N N
vg1007581489 T -> A LOC_Os10g13960.1 downstream_gene_variant ; 3106.0bp to feature; MODIFIER silent_mutation Average:36.375; most accessible tissue: Callus, score: 69.666 N N N N
vg1007581489 T -> A LOC_Os10g13950.1 intron_variant ; MODIFIER silent_mutation Average:36.375; most accessible tissue: Callus, score: 69.666 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007581489 1.50E-07 NA mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 6.44E-10 1.36E-21 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.13E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 1.32E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 5.91E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 2.90E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 4.21E-11 2.25E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.19E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 9.36E-08 NA mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 3.10E-10 6.67E-21 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 6.88E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 5.93E-10 3.87E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 6.92E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 6.29E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.07E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 2.72E-07 3.12E-18 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 1.17E-06 6.75E-14 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 7.73E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 1.92E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 4.34E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 2.45E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 1.17E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 5.33E-10 4.07E-29 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 1.95E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 1.83E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 6.90E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 8.16E-09 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 1.52E-09 2.67E-21 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.57E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 1.42E-07 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 2.71E-09 6.10E-32 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 1.19E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.39E-10 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 9.16E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 1.07E-06 9.94E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 5.12E-18 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 9.60E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 7.50E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 3.21E-11 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007581489 NA 7.61E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251