Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007474523:

Variant ID: vg1007474523 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7474523
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATTAATTTCGGCCGTTTAGCCAAAACTTGGATTTGACGAAACGGTAGCTACTTGATTAAACGAAATTCGGCCGTGATATAGCCGATTAGATCGTTCCC[C/A,T]
AGCGGAGTTGCCAAAAATCGTGTTGGCAACTTTTTTGACAAGTCGACAAGCACGATCGCAACACCTAAACGCCTTGCGATGATACAGAGTCGCCAACCAC

Reverse complement sequence

GTGGTTGGCGACTCTGTATCATCGCAAGGCGTTTAGGTGTTGCGATCGTGCTTGTCGACTTGTCAAAAAAGTTGCCAACACGATTTTTGGCAACTCCGCT[G/T,A]
GGGAACGATCTAATCGGCTATATCACGGCCGAATTTCGTTTAATCAAGTAGCTACCGTTTCGTCAAATCCAAGTTTTGGCTAAACGGCCGAAATTAATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.80%	1.00%	0.04%	0.00%	T: 0.17%
All Indica	2759	98.00%	1.70%	0.07%	0.00%	T: 0.29%
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.60%	5.00%	0.34%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.20%	0.00%	0.00%	0.00%	T: 0.77%
Indica Intermediate	786	98.20%	1.70%	0.00%	0.00%	T: 0.13%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007474523	C -> T	LOC_Os10g13740.1	upstream_gene_variant ; 4592.0bp to feature; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1007474523	C -> T	LOC_Os10g13760.1	downstream_gene_variant ; 1989.0bp to feature; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1007474523	C -> T	LOC_Os10g13740-LOC_Os10g13760	intergenic_region ; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1007474523	C -> A	LOC_Os10g13740.1	upstream_gene_variant ; 4592.0bp to feature; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1007474523	C -> A	LOC_Os10g13760.1	downstream_gene_variant ; 1989.0bp to feature; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1007474523	C -> A	LOC_Os10g13740-LOC_Os10g13760	intergenic_region ; MODIFIER	silent_mutation	Average:40.066; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007474523	NA	6.43E-07	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	2.37E-07	4.16E-10	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	7.31E-10	3.72E-12	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	3.44E-06	1.32E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	3.12E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	1.87E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	4.44E-07	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	1.21E-06	8.18E-06	mr1436	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	3.11E-06	NA	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	1.27E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	5.31E-06	mr1911	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	2.25E-08	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	1.24E-06	7.04E-11	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	1.73E-07	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	2.70E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	3.21E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007474523	NA	1.07E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251