Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006698817:

Variant ID: vg1006698817 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6698817
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, C: 0.05, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GACGATCAAGAACCACTTTGCCCACGTACATACACCGACAGCCATGGACACCCCGGCGTTGCTCCCGTTGGCGCTTGCCCTTGTTGCCATCCCGATCACC[A/C]
TCCTTCTTGATCTTCAATCGGATCCGCCTCGGCAGGCTGTCCCCCGGGCCCCGGGCGTGGCCGGTGGTAACCTGTTCGACATCACGCTGGTGCGGTGCCG

Reverse complement sequence

CGGCACCGCACCAGCGTGATGTCGAACAGGTTACCACCGGCCACGCCCGGGGCCCGGGGGACAGCCTGCCGAGGCGGATCCGATTGAAGATCAAGAAGGA[T/G]
GGTGATCGGGATGGCAACAAGGGCAAGCGCCAACGGGAGCAACGCCGGGGTGTCCATGGCTGTCGGTGTATGTACGTGGGCAAAGTGGTTCTTGATCGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 12.20% 14.05% 29.71% NA
All Indica  2759 38.60% 10.50% 13.85% 37.08% NA
All Japonica  1512 50.20% 14.60% 12.30% 22.95% NA
Aus  269 78.10% 1.10% 17.10% 3.72% NA
Indica I  595 11.80% 14.30% 23.36% 50.59% NA
Indica II  465 60.60% 7.30% 8.60% 23.44% NA
Indica III  913 38.40% 9.30% 9.97% 42.28% NA
Indica Intermediate  786 46.10% 10.80% 14.25% 28.88% NA
Temperate Japonica  767 74.60% 2.90% 11.60% 10.95% NA
Tropical Japonica  504 9.70% 34.10% 15.87% 40.28% NA
Japonica Intermediate  241 57.30% 10.80% 7.05% 24.90% NA
VI/Aromatic  96 9.40% 51.00% 37.50% 2.08% NA
Intermediate  90 43.30% 16.70% 15.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006698817 A -> C LOC_Os10g12050.1 5_prime_UTR_variant ; 2533.0bp to feature; MODIFIER silent_mutation Average:90.124; most accessible tissue: Minghui63 flag leaf, score: 98.322 N N N N
vg1006698817 A -> C LOC_Os10g12050.2 5_prime_UTR_variant ; 2533.0bp to feature; MODIFIER silent_mutation Average:90.124; most accessible tissue: Minghui63 flag leaf, score: 98.322 N N N N
vg1006698817 A -> DEL N N silent_mutation Average:90.124; most accessible tissue: Minghui63 flag leaf, score: 98.322 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006698817 A C -0.04 -0.02 -0.02 -0.03 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006698817 3.46E-06 3.46E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 2.59E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 8.90E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.29E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 6.35E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.26E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.88E-07 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.54E-08 mr1425 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 4.89E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.65E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 4.05E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 3.40E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 2.58E-06 mr1623 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 4.94E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 3.43E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 3.15E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 6.94E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 1.21E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 3.53E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 4.86E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006698817 NA 3.21E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251