Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006547989:

Variant ID: vg1006547989 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6547989
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACAGCCTTTGAGGCTGTGTTAGCATGCACCTTTTCCCATCCCCTCTCCCTCGTTTTCCGCGTGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTTT[A/T]
AAAAAAGTTTCTATACGAAAGTTGCTTAAAAAAATCAAATTAATCCATTTTTGAAAAAAAAAATAGCTAATACTTAATTAATCACGCGTTAATGGACTGC

Reverse complement sequence

GCAGTCCATTAACGCGTGATTAATTAAGTATTAGCTATTTTTTTTTTCAAAAATGGATTAATTTGATTTTTTTAAGCAACTTTCGTATAGAAACTTTTTT[T/A]
AAAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCACGCGGAAAACGAGGGAGAGGGGATGGGAAAAGGTGCATGCTAACACAGCCTCAAAGGCTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	43.80%	0.53%	0.47%	NA
All Indica	2759	40.70%	58.70%	0.51%	0.11%	NA
All Japonica	1512	73.70%	25.50%	0.73%	0.07%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	13.40%	85.40%	1.18%	0.00%	NA
Indica II	465	61.30%	38.30%	0.43%	0.00%	NA
Indica III	913	41.40%	58.30%	0.11%	0.22%	NA
Indica Intermediate	786	48.30%	51.00%	0.51%	0.13%	NA
Temperate Japonica	767	78.60%	20.20%	1.17%	0.00%	NA
Tropical Japonica	504	71.00%	28.60%	0.40%	0.00%	NA
Japonica Intermediate	241	63.50%	36.10%	0.00%	0.41%	NA
VI/Aromatic	96	49.00%	32.30%	0.00%	18.75%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006547989	A -> T	LOC_Os10g11810.1	downstream_gene_variant ; 3748.0bp to feature; MODIFIER	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N
vg1006547989	A -> T	LOC_Os10g11820.1	downstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N
vg1006547989	A -> T	LOC_Os10g11810.2	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N
vg1006547989	A -> T	LOC_Os10g11810.3	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N
vg1006547989	A -> T	LOC_Os10g11810-LOC_Os10g11820	intergenic_region ; MODIFIER	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N
vg1006547989	A -> DEL	N	N	silent_mutation	Average:77.457; most accessible tissue: Minghui63 root, score: 89.689	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1006547989	A	T	-0.01	-0.01	-0.01	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006547989	4.70E-06	NA	mr1147	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	6.72E-06	NA	mr1371	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	7.91E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	2.61E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	2.75E-08	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	3.52E-08	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	1.47E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	4.09E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	1.43E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989	NA	4.14E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251