Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006082586:

Variant ID: vg1006082586 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6082586
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCATTAAGTCCAGCAGCTTTCCCAAGAAGCTTTTTCAACTCCTTGCCAGACTTGCTCAGACCACCCTCTTCTTCATTCTCTTCATCATCCTAAAAGAA[T/C]
CCATTGTCACAGAATATTTGTTATTCTGATAGGGAACAGTCGCACCTATGAGCAAGAAAAAGTAGCAAATAACAAAAGGGAAGAGGAAAAGCATATTTGC

Reverse complement sequence

GCAAATATGCTTTTCCTCTTCCCTTTTGTTATTTGCTACTTTTTCTTGCTCATAGGTGCGACTGTTCCCTATCAGAATAACAAATATTCTGTGACAATGG[A/G]
TTCTTTTAGGATGATGAAGAGAATGAAGAAGAGGGTGGTCTGAGCAAGTCTGGCAAGGAGTTGAAAAAGCTTCTTGGGAAAGCTGCTGGACTTAATGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.50% 0.25% 0.00% NA
All Indica  2759 56.20% 43.30% 0.43% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 11.10% 88.70% 0.17% 0.00% NA
Indica II  465 76.30% 23.00% 0.65% 0.00% NA
Indica III  913 73.90% 25.60% 0.44% 0.00% NA
Indica Intermediate  786 57.90% 41.60% 0.51% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006082586 T -> C LOC_Os10g10990.1 intron_variant ; MODIFIER silent_mutation Average:54.665; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1006082586 T -> C LOC_Os10g10990.2 intron_variant ; MODIFIER silent_mutation Average:54.665; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1006082586 T -> C LOC_Os10g10990.3 intron_variant ; MODIFIER silent_mutation Average:54.665; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006082586 NA 2.07E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 8.46E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.75E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 9.22E-24 mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 1.34E-06 1.23E-17 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.44E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 8.29E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 8.89E-36 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 3.58E-18 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 4.16E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 2.57E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 4.81E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 3.18E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.96E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 7.43E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 8.17E-24 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 6.30E-06 4.25E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 4.41E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.02E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 6.03E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.01E-33 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.79E-19 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 5.21E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 2.92E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 4.21E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 6.39E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 1.00E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 4.99E-06 2.78E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 2.47E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 5.69E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006082586 NA 4.85E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251