Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005654495:

Variant ID: vg1005654495 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5654495
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGGACTGCCAGGTCCGGAACTTCCGGATAAAAAACCCGGAACTTCCGGACATGTTGACAGGAATAAATAGCGAGGGAGCTGCCAGGTTCGGAACTTC[C/T]
AGATAAGAGGATCCGGAACTTCCGGATAAACAGACGGAGTAGGCAGCAAGCAGCAAAAACAATATTTTGACCCCCTTCGATTGCAATTTTCTCCCCCTTT

Reverse complement sequence

AAAGGGGGAGAAAATTGCAATCGAAGGGGGTCAAAATATTGTTTTTGCTGCTTGCTGCCTACTCCGTCTGTTTATCCGGAAGTTCCGGATCCTCTTATCT[G/A]
GAAGTTCCGAACCTGGCAGCTCCCTCGCTATTTATTCCTGTCAACATGTCCGGAAGTTCCGGGTTTTTTATCCGGAAGTTCCGGACCTGGCAGTCCTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.00% 0.28% 0.00% NA
All Indica  2759 79.50% 20.30% 0.25% 0.00% NA
All Japonica  1512 81.20% 18.50% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 77.20% 22.40% 0.43% 0.00% NA
Indica III  913 69.90% 29.90% 0.22% 0.00% NA
Indica Intermediate  786 77.40% 22.30% 0.38% 0.00% NA
Temperate Japonica  767 89.20% 10.70% 0.13% 0.00% NA
Tropical Japonica  504 75.20% 24.60% 0.20% 0.00% NA
Japonica Intermediate  241 68.00% 30.70% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005654495 C -> T LOC_Os10g10280.1 upstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:45.034; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1005654495 C -> T LOC_Os10g10290.1 downstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:45.034; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1005654495 C -> T LOC_Os10g10300.1 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:45.034; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1005654495 C -> T LOC_Os10g10280-LOC_Os10g10290 intergenic_region ; MODIFIER silent_mutation Average:45.034; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005654495 NA 1.85E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 3.77E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.03E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.32E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 6.93E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 4.20E-09 2.10E-18 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.13E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 8.69E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.04E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.03E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 9.25E-08 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 1.37E-08 1.07E-21 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.81E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 7.11E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.92E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 7.17E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.92E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.77E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 6.36E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.06E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 1.45E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 1.11E-08 1.05E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.52E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.78E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.49E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 2.10E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 5.10E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 3.39E-06 2.19E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 1.87E-07 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 1.59E-08 1.54E-21 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 6.19E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 1.24E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005654495 NA 6.45E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251