Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005564884:

Variant ID: vg1005564884 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5564884
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.18, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAATAGGATATTGCATCGGATCGGTAATTGCAATGTCTCGCAATGAAAATATTACATTGCGAGTTCTCCATATTGCAACGAAAATACCCTTATTGCAA[T/C]
GTTTTCGCGTCGTTGTGCTTGGGCAAAATCCTTGTAGTGTCCACCACCACCACCGAGGCCTCCATTCATGCATTCGTCTCTCGCTCACGATTTCTTGAGC

Reverse complement sequence

GCTCAAGAAATCGTGAGCGAGAGACGAATGCATGAATGGAGGCCTCGGTGGTGGTGGTGGACACTACAAGGATTTTGCCCAAGCACAACGACGCGAAAAC[A/G]
TTGCAATAAGGGTATTTTCGTTGCAATATGGAGAACTCGCAATGTAATATTTTCATTGCGAGACATTGCAATTACCGATCCGATGCAATATCCTATTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.40%	35.00%	0.53%	26.07%	NA
All Indica	2759	28.20%	52.10%	0.36%	19.32%	NA
All Japonica	1512	61.60%	8.90%	0.60%	28.97%	NA
Aus	269	9.70%	4.50%	1.86%	84.01%	NA
Indica I	595	12.10%	86.60%	0.00%	1.34%	NA
Indica II	465	32.00%	49.70%	0.00%	18.28%	NA
Indica III	913	34.30%	34.50%	0.55%	30.67%	NA
Indica Intermediate	786	31.20%	47.80%	0.64%	20.36%	NA
Temperate Japonica	767	72.20%	11.50%	0.65%	15.65%	NA
Tropical Japonica	504	50.80%	2.80%	0.60%	45.83%	NA
Japonica Intermediate	241	50.20%	13.30%	0.41%	36.10%	NA
VI/Aromatic	96	36.50%	44.80%	1.04%	17.71%	NA
Intermediate	90	48.90%	31.10%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005564884	T -> C	LOC_Os10g10140.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:23.228; most accessible tissue: Callus, score: 45.268	N	N	N	N
vg1005564884	T -> C	LOC_Os10g10149.1	downstream_gene_variant ; 3940.0bp to feature; MODIFIER	silent_mutation	Average:23.228; most accessible tissue: Callus, score: 45.268	N	N	N	N
vg1005564884	T -> C	LOC_Os10g10140-LOC_Os10g10149	intergenic_region ; MODIFIER	silent_mutation	Average:23.228; most accessible tissue: Callus, score: 45.268	N	N	N	N
vg1005564884	T -> DEL	N	N	silent_mutation	Average:23.228; most accessible tissue: Callus, score: 45.268	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005564884	NA	7.79E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884	5.94E-07	5.94E-07	mr1281_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884	NA	1.87E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884	NA	6.25E-06	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884	NA	2.97E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884	6.04E-06	6.04E-06	mr1940_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251