Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005547004:

Variant ID: vg1005547004 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5547004
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, T: 0.09, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TGACTTGATTTGTTTTGTTATTTCGAATTTGCTATAATTTGTATATTACCATATGTATGTGTTAGAAACAAACACAAAAATAGGAAACTAGCTTTACCAA[A/T]
CAAAAATTTGTGTCCAGTTCCCATGGATGACTGACTAATTCCTAGCTAAATATCAAACAAAAATAAGCAATCACCTTAACCTCCAGCAGATTAAAGTACA

Reverse complement sequence

TGTACTTTAATCTGCTGGAGGTTAAGGTGATTGCTTATTTTTGTTTGATATTTAGCTAGGAATTAGTCAGTCATCCATGGGAACTGGACACAAATTTTTG[T/A]
TTGGTAAAGCTAGTTTCCTATTTTTGTGTTTGTTTCTAACACATACATATGGTAATATACAAATTATAGCAAATTCGAAATAACAAAACAAATCAAGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	36.10%	0.25%	26.13%	NA
All Indica	2759	21.70%	58.80%	0.14%	19.39%	NA
All Japonica	1512	68.30%	3.00%	0.26%	28.44%	NA
Aus	269	8.20%	3.30%	1.49%	86.99%	NA
Indica I	595	9.40%	89.60%	0.17%	0.84%	NA
Indica II	465	8.60%	73.50%	0.22%	17.63%	NA
Indica III	913	34.70%	33.80%	0.22%	31.22%	NA
Indica Intermediate	786	23.70%	55.60%	0.00%	20.74%	NA
Temperate Japonica	767	81.90%	2.50%	0.26%	15.38%	NA
Tropical Japonica	504	52.00%	2.20%	0.20%	45.63%	NA
Japonica Intermediate	241	59.30%	6.20%	0.41%	34.02%	NA
VI/Aromatic	96	74.00%	8.30%	0.00%	17.71%	NA
Intermediate	90	51.10%	27.80%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005547004	A -> T	LOC_Os10g10130.1	upstream_gene_variant ; 2424.0bp to feature; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> T	LOC_Os10g10130.4	upstream_gene_variant ; 4604.0bp to feature; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> T	LOC_Os10g10130.3	upstream_gene_variant ; 2426.0bp to feature; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> T	LOC_Os10g10130.2	upstream_gene_variant ; 2424.0bp to feature; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> T	LOC_Os10g10130.5	upstream_gene_variant ; 2424.0bp to feature; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> T	LOC_Os10g10130-LOC_Os10g10140	intergenic_region ; MODIFIER	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N
vg1005547004	A -> DEL	N	N	silent_mutation	Average:27.639; most accessible tissue: Callus, score: 70.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005547004	9.16E-06	2.98E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004	1.15E-07	1.15E-07	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004	NA	1.80E-12	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004	NA	2.86E-09	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004	NA	1.74E-06	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004	NA	4.17E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251