Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005433754:

Variant ID: vg1005433754 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5433754
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGCTTGTTGGTATTTGTTACGGTGATAGATAAATTTGTAAATGCATGAATACCGCTATATACCTTCACCTTAGAGTATTCCAAGGGTATCGAATCTG[C/T]
GGGAACATGTGTGTATATCTAGGAACTAAATTCTATCCAAAAACAATACCTAATGGTAGGCTTAGGAAAGAGAGGTTTCCTTTGGATTAATTAACTATAC

Reverse complement sequence

GTATAGTTAATTAATCCAAAGGAAACCTCTCTTTCCTAAGCCTACCATTAGGTATTGTTTTTGGATAGAATTTAGTTCCTAGATATACACACATGTTCCC[G/A]
CAGATTCGATACCCTTGGAATACTCTAAGGTGAAGGTATATAGCGGTATTCATGCATTTACAAATTTATCTATCACCGTAACAAATACCAACAAGCATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 12.40% 0.02% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 88.80% 11.20% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 82.50% 17.50% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005433754 C -> T LOC_Os10g10010.1 upstream_gene_variant ; 4098.0bp to feature; MODIFIER silent_mutation Average:45.154; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg1005433754 C -> T LOC_Os10g10020.1 upstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:45.154; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg1005433754 C -> T LOC_Os10g10010-LOC_Os10g10020 intergenic_region ; MODIFIER silent_mutation Average:45.154; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005433754 NA 2.46E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 3.51E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 8.37E-11 3.85E-34 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 8.93E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 8.64E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 2.95E-11 7.48E-40 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 8.57E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 1.26E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 6.58E-18 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 3.70E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 1.62E-13 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 7.13E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 2.96E-09 4.31E-39 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 2.57E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 2.45E-14 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 7.64E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 1.99E-21 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 6.98E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 2.43E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 8.64E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 8.41E-10 1.28E-29 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 4.51E-06 2.07E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 1.13E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 1.44E-06 1.50E-19 mr1409_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 5.18E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 2.40E-08 1.73E-12 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 5.36E-07 2.19E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 4.74E-12 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005433754 NA 6.53E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251