Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005356435:

Variant ID: vg1005356435 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5356435
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGTAGTGAAAAAACTACTACTCCCTCCGTAATAATATGCAGCTCTCTTTATTTAAAACATCATACTTTTATAGATATTGTTGGTTAAAGTAGCATTT[T/C]
AAAAACCGTGTCAAGGTCTAAAAATGTTTATATTTTATGACGGAGGAAGTACATAATTAGTTGTGAAGTTATCACATAGAAGAGAAAATTTGATTGGTAG

Reverse complement sequence

CTACCAATCAAATTTTCTCTTCTATGTGATAACTTCACAACTAATTATGTACTTCCTCCGTCATAAAATATAAACATTTTTAGACCTTGACACGGTTTTT[A/G]
AAATGCTACTTTAACCAACAATATCTATAAAAGTATGATGTTTTAAATAAAGAGAGCTGCATATTATTACGGAGGGAGTAGTAGTTTTTTCACTACTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	40.10%	0.83%	0.00%	NA
All Indica	2759	62.20%	37.40%	0.40%	0.00%	NA
All Japonica	1512	47.00%	52.80%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	59.30%	40.50%	0.17%	0.00%	NA
Indica II	465	69.90%	29.90%	0.22%	0.00%	NA
Indica III	913	64.30%	35.40%	0.33%	0.00%	NA
Indica Intermediate	786	57.40%	41.90%	0.76%	0.00%	NA
Temperate Japonica	767	33.20%	66.80%	0.00%	0.00%	NA
Tropical Japonica	504	66.30%	33.70%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	48.10%	1.24%	0.00%	NA
VI/Aromatic	96	54.20%	24.00%	21.88%	0.00%	NA
Intermediate	90	52.20%	43.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005356435	T -> C	LOC_Os10g09890.1	upstream_gene_variant ; 4306.0bp to feature; MODIFIER	silent_mutation	Average:44.743; most accessible tissue: Callus, score: 86.742	N	N	N	N
vg1005356435	T -> C	LOC_Os10g09880.1	downstream_gene_variant ; 3505.0bp to feature; MODIFIER	silent_mutation	Average:44.743; most accessible tissue: Callus, score: 86.742	N	N	N	N
vg1005356435	T -> C	LOC_Os10g09880-LOC_Os10g09890	intergenic_region ; MODIFIER	silent_mutation	Average:44.743; most accessible tissue: Callus, score: 86.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005356435	1.23E-06	NA	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435	NA	5.12E-10	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435	1.91E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435	NA	1.55E-11	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251