Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004886820:

Variant ID: vg1004886820 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4886820
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTACAAGTTGGCGAATGGGGTGCCACCCCTTCTAGACATAGAAACGCTTAAGAGAAGCAGCGTTCCAGGAGTGGTCGAACTCTTCGCCTTCCAGCGTC[G/A]
CCAAGCGAAAAGAGCCCGTCCTGGACCTGTTCTTGATGAGGTATGGCCCTTCCCACTTCGATTCAAGCTTTCCAACCGCCATTGGGTTCGCCTTCTTCCT

Reverse complement sequence

AGGAAGAAGGCGAACCCAATGGCGGTTGGAAAGCTTGAATCGAAGTGGGAAGGGCCATACCTCATCAAGAACAGGTCCAGGACGGGCTCTTTTCGCTTGG[C/T]
GACGCTGGAAGGCGAAGAGTTCGACCACTCCTGGAACGCTGCTTCTCTTAAGCGTTTCTATGTCTAGAAGGGGTGGCACCCCATTCGCCAACTTGTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.90%	0.47%	0.00%	NA
All Indica	2759	99.40%	0.10%	0.51%	0.00%	NA
All Japonica	1512	93.70%	5.80%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	0.00%	1.51%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.51%	0.00%	NA
Temperate Japonica	767	95.40%	4.40%	0.13%	0.00%	NA
Tropical Japonica	504	90.50%	8.50%	0.99%	0.00%	NA
Japonica Intermediate	241	95.00%	4.60%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004886820	G -> A	LOC_Os10g09030.1	missense_variant ; p.Ala164Val; MODERATE	nonsynonymous_codon ; A164V	Average:43.699; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	benign	0.746	TOLERATED	0.19

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004886820	NA	5.12E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	6.90E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	4.12E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	2.28E-06	2.28E-06	mr1424_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	3.87E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	6.61E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	2.34E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	7.91E-06	7.91E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	8.69E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	1.67E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	8.15E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	4.23E-06	mr1728_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820	NA	6.66E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251