Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004880631:

Variant ID: vg1004880631 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4880631
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCCCAACCAACCCACATGAACTACAGTGCATTGGGTTGATTTATTAAGTGTAAGACTAATCACGGTGAATCTGGTCAATCGCCCATAACCGCGGGCAC[G/T,A]
GCTATTCGAATAGTTTTACTCTGGCCAGAGGTGCACAACTGTACCCACAAGACACAATCTACCGGCATGTCACCGCGTCCGCGCAGATACGTCACCATGT

Reverse complement sequence

ACATGGTGACGTATCTGCGCGGACGCGGTGACATGCCGGTAGATTGTGTCTTGTGGGTACAGTTGTGCACCTCTGGCCAGAGTAAAACTATTCGAATAGC[C/A,T]
GTGCCCGCGGTTATGGGCGATTGACCAGATTCACCGTGATTAGTCTTACACTTAATAAATCAACCCAATGCACTGTAGTTCATGTGGGTTGGTTGGGCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	20.20%	2.12%	0.30%	NA
All Indica	2759	67.70%	28.60%	3.12%	0.51%	NA
All Japonica	1512	89.90%	9.60%	0.53%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	69.60%	26.70%	3.53%	0.17%	NA
Indica II	465	64.10%	28.60%	5.81%	1.51%	NA
Indica III	913	65.50%	31.50%	2.74%	0.22%	NA
Indica Intermediate	786	71.10%	26.70%	1.65%	0.51%	NA
Temperate Japonica	767	94.50%	5.30%	0.13%	0.00%	NA
Tropical Japonica	504	82.70%	16.50%	0.79%	0.00%	NA
Japonica Intermediate	241	90.00%	8.70%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	17.80%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004880631	G -> T	LOC_Os10g09020.1	upstream_gene_variant ; 471.0bp to feature; MODIFIER	silent_mutation	Average:51.217; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1004880631	G -> T	LOC_Os10g09000-LOC_Os10g09020	intergenic_region ; MODIFIER	silent_mutation	Average:51.217; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1004880631	G -> A	LOC_Os10g09020.1	upstream_gene_variant ; 471.0bp to feature; MODIFIER	N	Average:51.217; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1004880631	G -> A	LOC_Os10g09000-LOC_Os10g09020	intergenic_region ; MODIFIER	N	Average:51.217; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1004880631	G -> DEL	N	N	silent_mutation	Average:51.217; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004880631	6.58E-06	6.58E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004880631	5.61E-06	5.61E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004880631	1.10E-06	1.10E-06	mr1289_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004880631	NA	6.56E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251