Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004865986:

Variant ID: vg1004865986 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4865986
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCGATGTTGTTACTGCGAGAAAGTTATCCTGTTACTGCACGATGACCGTCATGTTACTGCGGAATTCCTGCGAGACGTGAACATCAAAGTGGTTGGC[G/A]
GGGAGGGAGTGAATGTGCGTGTTTGACGTGGGTTTGACCGGCGGGATGGGGTCACACGCGCCACCAATTTCCTGGCGCGCCTCCGCCCGTCCTGTCCTTG

Reverse complement sequence

CAAGGACAGGACGGGCGGAGGCGCGCCAGGAAATTGGTGGCGCGTGTGACCCCATCCCGCCGGTCAAACCCACGTCAAACACGCACATTCACTCCCTCCC[C/T]
GCCAACCACTTTGATGTTCACGTCTCGCAGGAATTCCGCAGTAACATGACGGTCATCGTGCAGTAACAGGATAACTTTCTCGCAGTAACAACATCGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	23.60%	0.25%	0.68%	NA
All Indica	2759	65.60%	33.70%	0.36%	0.33%	NA
All Japonica	1512	89.50%	10.40%	0.07%	0.07%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	69.10%	30.40%	0.50%	0.00%	NA
Indica II	465	61.70%	37.80%	0.22%	0.22%	NA
Indica III	913	62.40%	37.00%	0.11%	0.44%	NA
Indica Intermediate	786	68.80%	30.00%	0.64%	0.51%	NA
Temperate Japonica	767	94.70%	5.20%	0.13%	0.00%	NA
Tropical Japonica	504	81.50%	18.50%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.00%	0.41%	NA
VI/Aromatic	96	80.20%	0.00%	1.04%	18.75%	NA
Intermediate	90	68.90%	26.70%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004865986	G -> A	LOC_Os10g08990.1	upstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394	N	N	N	N
vg1004865986	G -> A	LOC_Os10g09000.1	downstream_gene_variant ; 2041.0bp to feature; MODIFIER	silent_mutation	Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394	N	N	N	N
vg1004865986	G -> A	LOC_Os10g08990-LOC_Os10g09000	intergenic_region ; MODIFIER	silent_mutation	Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394	N	N	N	N
vg1004865986	G -> DEL	N	N	silent_mutation	Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1004865986	G	A	0.0	0.02	0.03	0.06	0.04	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004865986	NA	3.83E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	7.00E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	5.58E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	2.50E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	4.81E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	5.32E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	1.90E-06	1.90E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	4.77E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	1.35E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	7.27E-07	7.27E-07	mr1250_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	1.11E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	3.69E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986	NA	3.40E-07	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251