Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004753931:

Variant ID: vg1004753931 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4753931
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTGGAAATAGATTATTCTAAAACAAATATGTATTGCAAGCATAGCTAGCTCTCCTTTATTTTAGTAATATTGACTGTCGAAATTGGTCTATAACGAC[C/T]
GTCAATAGCCGCCACCGCCCCCTCCCGTACGTCGCTTGCTCCCAGCCGTGCTCGTCCTTGTCGGCAGCGGTGCCAAGCTGCCGCCGTCCGCCGCCCGCCA

Reverse complement sequence

TGGCGGGCGGCGGACGGCGGCAGCTTGGCACCGCTGCCGACAAGGACGAGCACGGCTGGGAGCAAGCGACGTACGGGAGGGGGCGGTGGCGGCTATTGAC[G/A]
GTCGTTATAGACCAATTTCGACAGTCAATATTACTAAAATAAAGGAGAGCTAGCTATGCTTGCAATACATATTTGTTTTAGAATAATCTATTTCCACTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	26.00%	1.76%	1.84%	NA
All Indica	2759	60.50%	35.20%	2.83%	1.49%	NA
All Japonica	1512	82.80%	15.10%	0.20%	1.92%	NA
Aus	269	97.40%	1.90%	0.00%	0.74%	NA
Indica I	595	59.80%	37.00%	2.35%	0.84%	NA
Indica II	465	54.80%	41.90%	2.80%	0.43%	NA
Indica III	913	60.50%	33.30%	3.72%	2.52%	NA
Indica Intermediate	786	64.40%	32.10%	2.16%	1.40%	NA
Temperate Japonica	767	81.20%	14.90%	0.13%	3.78%	NA
Tropical Japonica	504	81.50%	18.30%	0.20%	0.00%	NA
Japonica Intermediate	241	90.50%	9.10%	0.41%	0.00%	NA
VI/Aromatic	96	85.40%	0.00%	0.00%	14.58%	NA
Intermediate	90	71.10%	25.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004753931	C -> T	LOC_Os10g08780.1	upstream_gene_variant ; 3582.0bp to feature; MODIFIER	silent_mutation	Average:62.39; most accessible tissue: Callus, score: 79.659	N	N	N	N
vg1004753931	C -> T	LOC_Os10g08760-LOC_Os10g08780	intergenic_region ; MODIFIER	silent_mutation	Average:62.39; most accessible tissue: Callus, score: 79.659	N	N	N	N
vg1004753931	C -> DEL	N	N	silent_mutation	Average:62.39; most accessible tissue: Callus, score: 79.659	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004753931	NA	1.42E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	NA	8.05E-07	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	NA	2.12E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	NA	9.87E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	NA	3.46E-09	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	3.59E-06	3.59E-06	mr1649_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931	NA	2.65E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251