Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004690394:

Variant ID: vg1004690394 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4690394
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGTGAGCTCGTCCTTCTCTCTGTCGGGCCGGAAAGTCCCCTGCGTAGAGGCTTCAATTGCATCCGCAAGTCAGCGTGCTGCATCTCGAATCTCATCGC[C/T]
GAATATGAGGGAGCCATCACCTGGATTGAGCGATCCACCGTGTGCATAGAACCAGTTCCTCGATCGCGCAGGCCAATTAGCCGTGGCCGGCTTGATACCC

Reverse complement sequence

GGGTATCAAGCCGGCCACGGCTAATTGGCCTGCGCGATCGAGGAACTGGTTCTATGCACACGGTGGATCGCTCAATCCAGGTGATGGCTCCCTCATATTC[G/A]
GCGATGAGATTCGAGATGCAGCACGCTGACTTGCGGATGCAATTGAAGCCTCTACGCAGGGGACTTTCCGGCCCGACAGAGAGAAGGACGAGCTCACCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	7.70%	15.51%	4.34%	NA
All Indica	2759	59.80%	12.30%	21.09%	6.78%	NA
All Japonica	1512	90.10%	1.10%	8.60%	0.13%	NA
Aus	269	95.20%	0.40%	0.74%	3.72%	NA
Indica I	595	58.30%	15.80%	20.84%	5.04%	NA
Indica II	465	54.80%	11.20%	29.03%	4.95%	NA
Indica III	913	61.10%	11.80%	17.74%	9.31%	NA
Indica Intermediate	786	62.50%	10.80%	20.48%	6.23%	NA
Temperate Japonica	767	94.90%	0.80%	4.04%	0.26%	NA
Tropical Japonica	504	82.50%	1.80%	15.67%	0.00%	NA
Japonica Intermediate	241	90.90%	0.80%	8.30%	0.00%	NA
VI/Aromatic	96	95.80%	1.00%	0.00%	3.12%	NA
Intermediate	90	68.90%	6.70%	21.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004690394	C -> T	LOC_Os10g08650.1	upstream_gene_variant ; 327.0bp to feature; MODIFIER	silent_mutation	Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg1004690394	C -> T	LOC_Os10g08640.1	downstream_gene_variant ; 3932.0bp to feature; MODIFIER	silent_mutation	Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg1004690394	C -> T	LOC_Os10g08660.1	downstream_gene_variant ; 320.0bp to feature; MODIFIER	silent_mutation	Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg1004690394	C -> T	LOC_Os10g08650-LOC_Os10g08660	intergenic_region ; MODIFIER	silent_mutation	Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg1004690394	C -> DEL	N	N	silent_mutation	Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004690394	4.69E-06	4.69E-06	mr1289_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394	7.19E-06	7.19E-06	mr1313_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394	8.69E-06	8.69E-06	mr1433_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394	2.36E-06	2.36E-06	mr1473_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394	7.21E-06	7.21E-06	mr1630_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394	NA	7.31E-07	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251