Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004561271:

Variant ID: vg1004561271 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4561271
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCCATTTGAGTTTCATTGAACTATATAAAATCTGAATTTTAAAATATAAGAAATTTAAAGAATTCTTCGGGTAGTAAATGATTTCAAATGGAAAAATT[G/A]
TCAAAAACTTATAAAGATCTACAACTTTTATGTTGGCCATTTTTCTATATGACTTTCTTTGAACAGTTTGAATTTGAATTTAAAAATATGAGAACTTCAA

Reverse complement sequence

TTGAAGTTCTCATATTTTTAAATTCAAATTCAAACTGTTCAAAGAAAGTCATATAGAAAAATGGCCAACATAAAAGTTGTAGATCTTTATAAGTTTTTGA[C/T]
AATTTTTCCATTTGAAATCATTTACTACCCGAAGAATTCTTTAAATTTCTTATATTTTAAAATTCAGATTTTATATAGTTCAATGAAACTCAAATGGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	5.20%	9.69%	34.85%	NA
All Indica	2759	38.30%	7.20%	14.72%	39.69%	NA
All Japonica	1512	79.30%	2.00%	2.65%	16.07%	NA
Aus	269	1.50%	1.10%	1.12%	96.28%	NA
Indica I	595	20.20%	4.90%	10.59%	64.37%	NA
Indica II	465	30.80%	8.20%	19.14%	41.94%	NA
Indica III	913	46.00%	10.40%	17.09%	26.51%	NA
Indica Intermediate	786	47.70%	4.80%	12.47%	34.99%	NA
Temperate Japonica	767	93.50%	1.40%	1.56%	3.52%	NA
Tropical Japonica	504	63.70%	2.00%	2.38%	31.94%	NA
Japonica Intermediate	241	66.80%	3.70%	6.64%	22.82%	NA
VI/Aromatic	96	65.60%	9.40%	2.08%	22.92%	NA
Intermediate	90	58.90%	2.20%	7.78%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004561271	G -> A	LOC_Os10g08390.1	downstream_gene_variant ; 3381.0bp to feature; MODIFIER	silent_mutation	Average:17.601; most accessible tissue: Callus, score: 46.389	N	N	N	N
vg1004561271	G -> A	LOC_Os10g08400.1	downstream_gene_variant ; 1278.0bp to feature; MODIFIER	silent_mutation	Average:17.601; most accessible tissue: Callus, score: 46.389	N	N	N	N
vg1004561271	G -> A	LOC_Os10g08390-LOC_Os10g08400	intergenic_region ; MODIFIER	silent_mutation	Average:17.601; most accessible tissue: Callus, score: 46.389	N	N	N	N
vg1004561271	G -> DEL	N	N	silent_mutation	Average:17.601; most accessible tissue: Callus, score: 46.389	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004561271	2.20E-06	2.20E-06	mr1493	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	8.09E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	4.46E-07	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	4.33E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	7.75E-06	mr1603_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	7.50E-06	NA	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	3.28E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	8.24E-06	NA	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	2.11E-06	2.11E-06	mr1853_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004561271	NA	1.87E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251