Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004560628:

Variant ID: vg1004560628 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4560628
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCTACCGGGTTTCAGCATGGTTTATAACCAGAGGAGACGTGGTGCTGTGACTGCGGGGCTCAGTAGCATGTTCGTTCAGAAGAAGGATCGAATTTCGTCA[C/T]
GACTCCGTCCAAATCGTCTGTTTATCAATACATATCGGAAGATCAGGACCTAACATCCTCATCATTTGTTCAGTCGCGTGACTACCGTGGGGAAAGGCCG

Reverse complement sequence

CGGCCTTTCCCCACGGTAGTCACGCGACTGAACAAATGATGAGGATGTTAGGTCCTGATCTTCCGATATGTATTGATAAACAGACGATTTGGACGGAGTC[G/A]
TGACGAAATTCGATCCTTCTTCTGAACGAACATGCTACTGAGCCCCGCAGTCACAGCACCACGTCTCCTCTGGTTATAAACCATGCTGAAACCCGGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	39.00%	0.61%	16.93%	NA
All Indica	2759	33.70%	50.90%	0.69%	14.72%	NA
All Japonica	1512	69.00%	23.10%	0.33%	7.54%	NA
Aus	269	1.50%	5.20%	1.49%	91.82%	NA
Indica I	595	20.00%	41.50%	1.51%	36.97%	NA
Indica II	465	29.20%	60.60%	0.65%	9.46%	NA
Indica III	913	36.00%	59.10%	0.11%	4.71%	NA
Indica Intermediate	786	44.00%	42.60%	0.76%	12.60%	NA
Temperate Japonica	767	72.80%	26.70%	0.13%	0.39%	NA
Tropical Japonica	504	65.50%	12.90%	0.60%	21.03%	NA
Japonica Intermediate	241	64.70%	32.80%	0.41%	2.07%	NA
VI/Aromatic	96	30.20%	52.10%	0.00%	17.71%	NA
Intermediate	90	51.10%	30.00%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004560628	C -> T	LOC_Os10g08390.1	downstream_gene_variant ; 2738.0bp to feature; MODIFIER	silent_mutation	Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1004560628	C -> T	LOC_Os10g08400.1	downstream_gene_variant ; 1921.0bp to feature; MODIFIER	silent_mutation	Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1004560628	C -> T	LOC_Os10g08390-LOC_Os10g08400	intergenic_region ; MODIFIER	silent_mutation	Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1004560628	C -> DEL	N	N	silent_mutation	Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004560628	3.91E-06	NA	mr1020	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	8.57E-06	1.96E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	NA	4.17E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	5.10E-06	1.76E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	5.36E-06	NA	mr1735	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	NA	1.85E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628	NA	5.68E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251