Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004519208:

Variant ID: vg1004519208 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4519208
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTAGAAAAAATGATATGATACGGTTTATTGAGAGAAGAGATAAATATCATTAACTACAATTATTAGGATAAACTTTAATAGATATTTATGACAAGTAA[A/G]
CTAGATGAGAGCCTTTGGACCATACAGCACGATTGATCAACCCTATCTGTAAATTTAGGCAACGTAGGAACTTCAAAACCTACTAGATCAAGTGAATACG

Reverse complement sequence

CGTATTCACTTGATCTAGTAGGTTTTGAAGTTCCTACGTTGCCTAAATTTACAGATAGGGTTGATCAATCGTGCTGTATGGTCCAAAGGCTCTCATCTAG[T/C]
TTACTTGTCATAAATATCTATTAAAGTTTATCCTAATAATTGTAGTTAATGATATTTATCTCTTCTCTCAATAAACCGTATCATATCATTTTTTCTAACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	13.10%	0.00%	2.43%	NA
All Indica	2759	99.10%	0.60%	0.00%	0.29%	NA
All Japonica	1512	54.00%	39.10%	0.00%	6.88%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.00%	0.10%	0.00%	0.88%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	33.60%	66.40%	0.00%	0.00%	NA
Tropical Japonica	504	76.80%	3.00%	0.00%	20.24%	NA
Japonica Intermediate	241	71.40%	27.80%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	14.40%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004519208	A -> G	LOC_Os10g08340.1	upstream_gene_variant ; 3854.0bp to feature; MODIFIER	silent_mutation	Average:55.243; most accessible tissue: Callus, score: 93.444	N	N	N	N
vg1004519208	A -> G	LOC_Os10g08350.1	upstream_gene_variant ; 4805.0bp to feature; MODIFIER	silent_mutation	Average:55.243; most accessible tissue: Callus, score: 93.444	N	N	N	N
vg1004519208	A -> G	LOC_Os10g08340-LOC_Os10g08350	intergenic_region ; MODIFIER	silent_mutation	Average:55.243; most accessible tissue: Callus, score: 93.444	N	N	N	N
vg1004519208	A -> DEL	N	N	silent_mutation	Average:55.243; most accessible tissue: Callus, score: 93.444	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004519208	NA	3.70E-19	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	4.53E-06	NA	mr1403_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	1.79E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	1.16E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	1.67E-06	3.87E-29	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	4.64E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	3.83E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	7.13E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208	NA	3.84E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251