Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004372914:

Variant ID: vg1004372914 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4372914
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAACAAGTAAAATATATCAAACAAGAGCCTAATATACTTAAATGCAGTAAGATCTTGACATAAAGGGCAGATTTAATGTATCATTGAAGCATATAGAG[C/A]
AAATATAATTAAATCAGGTAAGATCGGCTGAAACTCCGATACTATTCTAATCGGCAACCAGGAGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAAT

Reverse complement sequence

ATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCTCCTGGTTGCCGATTAGAATAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAATTATATTT[G/T]
CTCTATATGCTTCAATGATACATTAAATCTGCCCTTTATGTCAAGATCTTACTGCATTTAAGTATATTAGGCTCTTGTTTGATATATTTTACTTGTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	16.00%	3.68%	26.11%	NA
All Indica	2759	59.60%	16.40%	2.79%	21.28%	NA
All Japonica	1512	54.60%	1.20%	5.49%	38.69%	NA
Aus	269	5.60%	92.90%	0.74%	0.74%	NA
Indica I	595	45.70%	42.40%	3.70%	8.24%	NA
Indica II	465	69.50%	10.50%	2.37%	17.63%	NA
Indica III	913	60.00%	3.20%	2.63%	34.17%	NA
Indica Intermediate	786	63.60%	15.50%	2.54%	18.32%	NA
Temperate Japonica	767	77.70%	0.40%	7.04%	14.86%	NA
Tropical Japonica	504	23.60%	2.00%	3.77%	70.63%	NA
Japonica Intermediate	241	46.10%	2.10%	4.15%	47.72%	NA
VI/Aromatic	96	30.20%	19.80%	8.33%	41.67%	NA
Intermediate	90	54.40%	18.90%	4.44%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004372914	C -> A	LOC_Os10g08080.1	upstream_gene_variant ; 1194.0bp to feature; MODIFIER	silent_mutation	Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg1004372914	C -> A	LOC_Os10g08060.1	downstream_gene_variant ; 2056.0bp to feature; MODIFIER	silent_mutation	Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg1004372914	C -> A	LOC_Os10g08070.1	downstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg1004372914	C -> A	LOC_Os10g08070-LOC_Os10g08080	intergenic_region ; MODIFIER	silent_mutation	Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg1004372914	C -> DEL	N	N	silent_mutation	Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004372914	4.14E-06	3.52E-07	mr1087	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914	4.42E-06	1.23E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914	2.73E-06	2.77E-07	mr1094	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914	NA	2.16E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251