Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004372674:

Variant ID: vg1004372674 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4372674
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGGCAATAAAGAGCTAAATCTATTCGATCGGCTGTAGATATTAACAATATATAGTTCCTATACCGATATATACTTAAATCAAGTGACAGGGATAGATC[A/G]
GTCGCCATGCCGAGACAGTATGAATCACTTAGATCGAAATATATATTGATAACAACCTTATATATCTTAATAGCATAGCCGATCAGATAGATCTAGCGTG

Reverse complement sequence

CACGCTAGATCTATCTGATCGGCTATGCTATTAAGATATATAAGGTTGTTATCAATATATATTTCGATCTAAGTGATTCATACTGTCTCGGCATGGCGAC[T/C]
GATCTATCCCTGTCACTTGATTTAAGTATATATCGGTATAGGAACTATATATTGTTAATATCTACAGCCGATCGAATAGATTTAGCTCTTTATTGCCTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	18.90%	2.31%	27.63%	NA
All Indica	2759	53.30%	20.50%	3.26%	22.91%	NA
All Japonica	1512	57.90%	1.60%	0.93%	39.62%	NA
Aus	269	4.10%	94.10%	0.37%	1.49%	NA
Indica I	595	46.40%	42.50%	2.02%	9.08%	NA
Indica II	465	64.90%	11.80%	3.66%	19.57%	NA
Indica III	913	47.40%	12.20%	4.05%	36.36%	NA
Indica Intermediate	786	58.50%	18.70%	3.05%	19.72%	NA
Temperate Japonica	767	83.60%	0.30%	0.78%	15.38%	NA
Tropical Japonica	504	24.40%	2.40%	1.39%	71.83%	NA
Japonica Intermediate	241	46.10%	4.10%	0.41%	49.38%	NA
VI/Aromatic	96	18.80%	26.00%	4.17%	51.04%	NA
Intermediate	90	46.70%	28.90%	0.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004372674	A -> G	LOC_Os10g08050.1	upstream_gene_variant ; 4764.0bp to feature; MODIFIER	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg1004372674	A -> G	LOC_Os10g08080.1	upstream_gene_variant ; 1434.0bp to feature; MODIFIER	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg1004372674	A -> G	LOC_Os10g08060.1	downstream_gene_variant ; 1816.0bp to feature; MODIFIER	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg1004372674	A -> G	LOC_Os10g08070.1	downstream_gene_variant ; 469.0bp to feature; MODIFIER	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg1004372674	A -> G	LOC_Os10g08070-LOC_Os10g08080	intergenic_region ; MODIFIER	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg1004372674	A -> DEL	N	N	silent_mutation	Average:14.698; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004372674	6.48E-06	1.05E-07	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	NA	1.54E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	2.77E-06	6.25E-08	mr1094	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	2.97E-06	1.11E-07	mr1096	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	NA	1.72E-06	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	2.23E-06	2.23E-06	mr1144	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	NA	6.91E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	NA	1.13E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372674	NA	2.07E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251