Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004077056:

Variant ID: vg1004077056 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4077056
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCCACCAATATAAGGGATTCTAGAGTACTACTTATCCCATCAATCACATTGATTTCATTAAAAAAATTCGTATTATCCCCGACTACACTCACACAT[T/C]
CAGCATCTCATTTAACCAAGGGCATCATTGTTTTTCTCTGCATACCCAAAGTCTGTAGTATTTGTTGATGGAGGGAATACACAAAAGACCACCCATTTGT

Reverse complement sequence

ACAAATGGGTGGTCTTTTGTGTATTCCCTCCATCAACAAATACTACAGACTTTGGGTATGCAGAGAAAAACAATGATGCCCTTGGTTAAATGAGATGCTG[A/G]
ATGTGTGAGTGTAGTCGGGGATAATACGAATTTTTTTAATGAAATCAATGTGATTGATGGGATAAGTAGTACTCTAGAATCCCTTATATTGGTGGACGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.50% 0.19% 0.00% NA
All Indica  2759 43.30% 56.40% 0.29% 0.00% NA
All Japonica  1512 90.80% 9.20% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 43.40% 56.00% 0.67% 0.00% NA
Indica II  465 50.80% 49.20% 0.00% 0.00% NA
Indica III  913 44.60% 55.30% 0.11% 0.00% NA
Indica Intermediate  786 37.30% 62.30% 0.38% 0.00% NA
Temperate Japonica  767 83.60% 16.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004077056 T -> C LOC_Os10g07554.1 downstream_gene_variant ; 3114.0bp to feature; MODIFIER silent_mutation Average:40.339; most accessible tissue: Callus, score: 70.731 N N N N
vg1004077056 T -> C LOC_Os10g07556.1 intron_variant ; MODIFIER silent_mutation Average:40.339; most accessible tissue: Callus, score: 70.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004077056 NA 9.80E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 6.50E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 6.24E-06 1.52E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 2.20E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 5.59E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 1.47E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 8.58E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 2.81E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 7.63E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 1.18E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 7.93E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 3.37E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 2.98E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 2.59E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 1.93E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 2.18E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 1.47E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 4.33E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 3.34E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004077056 NA 8.05E-08 mr1994_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251