Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004032949:

Variant ID: vg1004032949 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4032949
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

GGGATCTGAAACGCCATGCGATGACACCGACAAGCTACTGTTCGTAGCAGCAGCAACAATACAAATTGGTGATGGGGCAAACGCGAAATTCTGGGACTCC[G/A]
CTTGGCTAAAGGGAGAAGGCTGAAGGATATTGCCCCCGCTAGTCTATGCGATTTCCAAGAAGAAGAGCACTGCTCTCCAACAAGCCGCTCTTGTGGACCA

Reverse complement sequence

TGGTCCACAAGAGCGGCTTGTTGGAGAGCAGTGCTCTTCTTCTTGGAAATCGCATAGACTAGCGGGGGCAATATCCTTCAGCCTTCTCCCTTTAGCCAAG[C/T]
GGAGTCCCAGAATTTCGCGTTTGCCCCATCACCAATTTGTATTGTTGCTGCTGCTACGAACAGTAGCTTGTCGGTGTCATCGCATGGCGTTTCAGATCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	7.30%	2.54%	1.25%	NA
All Indica	2759	89.90%	5.50%	3.23%	1.34%	NA
All Japonica	1512	85.00%	11.60%	2.05%	1.39%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.60%	0.00%	4.54%	0.84%	NA
Indica II	465	83.40%	12.30%	3.44%	0.86%	NA
Indica III	913	89.00%	7.70%	1.64%	1.64%	NA
Indica Intermediate	786	91.20%	3.20%	3.94%	1.65%	NA
Temperate Japonica	767	92.70%	7.00%	0.13%	0.13%	NA
Tropical Japonica	504	78.60%	11.90%	5.75%	3.77%	NA
Japonica Intermediate	241	73.90%	25.30%	0.41%	0.41%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004032949	G -> A	LOC_Os10g07534.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1004032949	G -> A	LOC_Os10g07536.1	downstream_gene_variant ; 177.0bp to feature; MODIFIER	silent_mutation	Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1004032949	G -> A	LOC_Os10g07538.1	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1004032949	G -> A	LOC_Os10g07536-LOC_Os10g07538	intergenic_region ; MODIFIER	silent_mutation	Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1004032949	G -> DEL	N	N	silent_mutation	Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004032949	NA	6.69E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949	8.39E-06	8.39E-06	mr1493	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949	NA	4.49E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949	8.18E-07	NA	mr1706	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949	NA	1.23E-09	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251