Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003464531:

Variant ID: vg1003464531 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3464531
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, C: 0.14, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATCCAGTATAATAATTACTGAATTTGGTACAAAAACGATTGAATCCGACTATAAAAAACGACTGAATTTACTAATAATGGAACATGAACCGAGATTT[G/C]
ATGAAGCTAATCTCTTCTAGGCGAGGAGGTTGAAGAGGGCCTTGTCGGCGAGGTGGTGCGCGGCGTGGATGAGGTCAATCCGCGCGTCGTGGGTGAGCCC

Reverse complement sequence

GGGCTCACCCACGACGCGCGGATTGACCTCATCCACGCCGCGCACCACCTCGCCGACAAGGCCCTCTTCAACCTCCTCGCCTAGAAGAGATTAGCTTCAT[C/G]
AAATCTCGGTTCATGTTCCATTATTAGTAAATTCAGTCGTTTTTTATAGTCGGATTCAATCGTTTTTGTACCAAATTCAGTAATTATTATACTGGATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.40% 0.21% 0.00% NA
All Indica  2759 56.90% 42.80% 0.33% 0.00% NA
All Japonica  1512 35.50% 64.50% 0.00% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 55.80% 44.00% 0.17% 0.00% NA
Indica II  465 74.80% 24.90% 0.22% 0.00% NA
Indica III  913 40.50% 59.30% 0.22% 0.00% NA
Indica Intermediate  786 66.20% 33.20% 0.64% 0.00% NA
Temperate Japonica  767 42.80% 57.20% 0.00% 0.00% NA
Tropical Japonica  504 25.20% 74.80% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003464531 G -> C LOC_Os10g06690.1 3_prime_UTR_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:81.691; most accessible tissue: Zhenshan97 flower, score: 91.994 N N N N
vg1003464531 G -> C LOC_Os10g06700.1 upstream_gene_variant ; 3475.0bp to feature; MODIFIER silent_mutation Average:81.691; most accessible tissue: Zhenshan97 flower, score: 91.994 N N N N
vg1003464531 G -> C LOC_Os10g06670.1 downstream_gene_variant ; 4134.0bp to feature; MODIFIER silent_mutation Average:81.691; most accessible tissue: Zhenshan97 flower, score: 91.994 N N N N
vg1003464531 G -> C LOC_Os10g06680.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:81.691; most accessible tissue: Zhenshan97 flower, score: 91.994 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003464531 G C -0.04 -0.06 -0.05 -0.03 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003464531 5.79E-06 5.79E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 3.96E-06 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 8.57E-12 9.53E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 1.95E-18 7.56E-21 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 2.27E-18 1.99E-24 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 6.18E-42 1.27E-65 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 4.87E-45 1.20E-74 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 9.91E-06 9.00E-11 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 NA 1.12E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 NA 1.68E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 NA 5.74E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 NA 2.03E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 7.77E-08 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 5.18E-12 6.21E-18 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 1.49E-17 6.83E-24 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 6.63E-20 8.50E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 4.72E-06 4.72E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 4.25E-75 6.17E-127 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 4.37E-78 1.20E-134 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003464531 4.20E-15 7.42E-35 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251