Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003446306:

Variant ID: vg1003446306 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3446306
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAAAGCCGCTCCACTACAAGGGCTCAACGTTCCACCGGGTGGTGCCCGGGTTCATGTGCCAGAGCGGCGACATCGTGACGGCGAGTCAGCGCTTGACG[G/A]
CGCCTGGAGGCTAGTGATTGAAATTTCAGTAATTTCACCCCACCGGCAAGCATATATCTCGCCTGAAAATTTCGGTTATTTATATTTATTTTGCAAATTT

Reverse complement sequence

AAATTTGCAAAATAAATATAAATAACCGAAATTTTCAGGCGAGATATATGCTTGCCGGTGGGGTGAAATTACTGAAATTTCAATCACTAGCCTCCAGGCG[C/T]
CGTCAAGCGCTGACTCGCCGTCACGATGTCGCCGCTCTGGCACATGAACCCGGGCACCACCCGGTGGAACGTTGAGCCCTTGTAGTGGAGCGGCTTTCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.20%	0.11%	0.49%	NA
All Indica	2759	60.40%	38.60%	0.18%	0.80%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	88.10%	11.90%	0.00%	0.00%	NA
Indica I	595	55.80%	42.70%	0.50%	1.01%	NA
Indica II	465	74.00%	24.10%	0.22%	1.72%	NA
Indica III	913	49.40%	49.90%	0.00%	0.66%	NA
Indica Intermediate	786	68.70%	30.90%	0.13%	0.25%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	66.70%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003446306	G -> A	LOC_Os10g06640.1	upstream_gene_variant ; 205.0bp to feature; MODIFIER	silent_mutation	Average:85.669; most accessible tissue: Zhenshan97 flower, score: 90.586	N	N	N	N
vg1003446306	G -> A	LOC_Os10g06630-LOC_Os10g06640	intergenic_region ; MODIFIER	silent_mutation	Average:85.669; most accessible tissue: Zhenshan97 flower, score: 90.586	N	N	N	N
vg1003446306	G -> DEL	N	N	silent_mutation	Average:85.669; most accessible tissue: Zhenshan97 flower, score: 90.586	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1003446306	G	A	-0.06	-0.04	-0.04	-0.07	-0.08	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003446306	6.41E-09	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	1.67E-11	1.54E-13	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	1.57E-17	2.66E-22	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	2.76E-16	4.29E-22	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	2.24E-44	8.87E-47	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	4.16E-45	9.47E-73	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	NA	7.58E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	NA	9.91E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	2.13E-10	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	7.47E-14	2.07E-20	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	1.35E-16	1.37E-18	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	1.20E-19	9.29E-28	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	1.73E-77	2.82E-85	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446306	2.03E-75	2.28E-123	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251