Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003189276:

Variant ID: vg1003189276 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3189276
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, A: 0.41, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCTGGAGGGGATCTCCTCCATCGCCTTAGCCAGTTCCGTGAGCGACGATGTCAGCAACCACTCGTCGGGATGCGCTGGGATCGAAGTTGTGACACCG[A/C]
ACTCCCCGGCGAGTTGGTGCACGCCGGTGAACGATGTCCGCAGCGAACCTCGGATGGCTGTCAGATGGCCCTCGAGCTCCGACATACGGTGCTCGAGTCC

Reverse complement sequence

GGACTCGAGCACCGTATGTCGGAGCTCGAGGGCCATCTGACAGCCATCCGAGGTTCGCTGCGGACATCGTTCACCGGCGTGCACCAACTCGCCGGGGAGT[T/G]
CGGTGTCACAACTTCGATCCCAGCGCATCCCGACGAGTGGTTGCTGACATCGTCGCTCACGGAACTGGCTAAGGCGATGGAGGAGATCCCCTCCAGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.30%	36.50%	0.51%	21.63%	NA
All Indica	2759	56.30%	7.20%	0.76%	35.74%	NA
All Japonica	1512	3.80%	95.90%	0.07%	0.26%	NA
Aus	269	92.90%	4.10%	0.00%	2.97%	NA
Indica I	595	51.10%	8.10%	1.68%	39.16%	NA
Indica II	465	74.00%	1.90%	0.86%	23.23%	NA
Indica III	913	42.50%	10.10%	0.22%	47.21%	NA
Indica Intermediate	786	65.90%	6.20%	0.64%	27.23%	NA
Temperate Japonica	767	0.40%	99.20%	0.13%	0.26%	NA
Tropical Japonica	504	10.10%	89.70%	0.00%	0.20%	NA
Japonica Intermediate	241	1.20%	98.30%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	31.20%	0.00%	15.62%	NA
Intermediate	90	46.70%	41.10%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003189276	A -> C	LOC_Os10g06200.1	upstream_gene_variant ; 4179.0bp to feature; MODIFIER	silent_mutation	Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg1003189276	A -> C	LOC_Os10g06220.1	upstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg1003189276	A -> C	LOC_Os10g06210.1	intron_variant ; MODIFIER	silent_mutation	Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg1003189276	A -> DEL	N	N	silent_mutation	Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003189276	NA	1.53E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	5.99E-08	6.90E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	3.35E-07	8.83E-13	mr1709	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	NA	3.82E-07	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	5.57E-06	NA	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	2.16E-06	2.36E-10	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	9.62E-11	9.84E-16	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276	9.79E-08	1.70E-19	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251