Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003131226:

Variant ID: vg1003131226 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3131226
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TACGAGACAATTGTTCACTATAGTTCATTTATTTATAGTGATTGCTTTAGTGTTTGATTGGCACTAGAGTAGTTATTAATTGCGTAGACGCGGTGTCTGG[G/A]
TAATTAATCTTCAGTGGTTGCTGCGTATCCCATAGTACATTTGAGGTAGGTGTAGAGGTGGTGACAGCCCTAGACACTATTTCTCTAGACACTGTTAAAC

Reverse complement sequence

GTTTAACAGTGTCTAGAGAAATAGTGTCTAGGGCTGTCACCACCTCTACACCTACCTCAAATGTACTATGGGATACGCAGCAACCACTGAAGATTAATTA[C/T]
CCAGACACCGCGTCTACGCAATTAATAACTACTCTAGTGCCAATCAAACACTAAAGCAATCACTATAAATAAATGAACTATAGTGAACAATTGTCTCGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.00%	0.28%	0.00%	NA
All Indica	2759	53.40%	46.20%	0.40%	0.00%	NA
All Japonica	1512	96.80%	3.20%	0.00%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	49.10%	50.80%	0.17%	0.00%	NA
Indica II	465	56.30%	43.00%	0.65%	0.00%	NA
Indica III	913	61.70%	38.00%	0.33%	0.00%	NA
Indica Intermediate	786	45.30%	54.20%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	90.90%	9.10%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	24.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003131226	G -> A	LOC_Os10g06140.1	upstream_gene_variant ; 3954.0bp to feature; MODIFIER	silent_mutation	Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg1003131226	G -> A	LOC_Os10g06140-LOC_Os10g06160	intergenic_region ; MODIFIER	silent_mutation	Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003131226	4.85E-08	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	7.80E-10	2.31E-12	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	3.18E-17	5.16E-13	mr1547	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	5.88E-18	2.22E-22	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	1.10E-22	1.49E-31	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	4.38E-23	1.91E-33	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	7.03E-10	6.56E-14	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	5.71E-16	4.26E-19	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	3.19E-18	1.63E-27	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	2.02E-39	1.91E-43	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226	5.58E-34	4.00E-54	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251