Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003045443:

Variant ID: vg1003045443 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3045443
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AATATGCATTACTGTACAGCAATCTGGAAATTAGCACAGGCTGAAACTGGACAGTTCCCAATTGAAGCCCGTGCTTTATTTGATATATTTGCCTACCTAT[T/C]
TATCATATATCTTAGTTAATCTAAGTCGATTATTTAAATTTACTTATATCGGTCAGATCTTTTCTAGGGTTTTGCCAGTATCGGCTAAATTGTTTTGTCG

Reverse complement sequence

CGACAAAACAATTTAGCCGATACTGGCAAAACCCTAGAAAAGATCTGACCGATATAAGTAAATTTAAATAATCGACTTAGATTAACTAAGATATATGATA[A/G]
ATAGGTAGGCAAATATATCAAATAAAGCACGGGCTTCAATTGGGAACTGTCCAGTTTCAGCCTGTGCTAATTTCCAGATTGCTGTACAGTAATGCATATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	21.60%	0.04%	0.00%	NA
All Indica	2759	63.60%	36.40%	0.04%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	55.50%	44.50%	0.00%	0.00%	NA
Indica II	465	75.50%	24.50%	0.00%	0.00%	NA
Indica III	913	56.40%	43.50%	0.11%	0.00%	NA
Indica Intermediate	786	71.00%	29.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003045443	T -> C	LOC_Os10g06010.1	downstream_gene_variant ; 1027.0bp to feature; MODIFIER	silent_mutation	Average:42.602; most accessible tissue: Callus, score: 70.089	N	N	N	N
vg1003045443	T -> C	LOC_Os10g06000-LOC_Os10g06010	intergenic_region ; MODIFIER	silent_mutation	Average:42.602; most accessible tissue: Callus, score: 70.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003045443	8.48E-11	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	2.83E-11	2.68E-13	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	4.23E-19	2.58E-23	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	1.35E-16	2.10E-22	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	5.15E-52	5.97E-60	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	1.91E-46	5.61E-74	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	NA	1.10E-06	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	NA	9.07E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	NA	1.09E-06	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	1.92E-11	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	6.39E-14	2.46E-20	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	6.75E-20	3.14E-25	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	5.79E-20	4.48E-28	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	2.83E-94	1.22E-108	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443	2.29E-76	1.35E-124	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251