Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003005565:

Variant ID: vg1003005565 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3005565
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGGGTTATTTGTTCGGTATGAAAAGTTTGGGGTGTAGAATATTTGGTTTTGTAGCTTATGGGGTAATTCATACTAGCTTAATAGTTCAGGAGGTAATT[C/T]
ATACTTTTTCCTTGTATAAAAGCCCAAATAACTAAATAATTAAATAATGTCTTTATAATGCAACATAATTTCTGTGATAAATATGAAAAATCGAATTATG

Reverse complement sequence

CATAATTCGATTTTTCATATTTATCACAGAAATTATGTTGCATTATAAAGACATTATTTAATTATTTAGTTATTTGGGCTTTTATACAAGGAAAAAGTAT[G/A]
AATTACCTCCTGAACTATTAAGCTAGTATGAATTACCCCATAAGCTACAAAACCAAATATTCTACACCCCAAACTTTTCATACCGAACAAATAACCCCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	0.20%	1.78%	16.84%	NA
All Indica	2759	88.60%	0.10%	2.28%	8.99%	NA
All Japonica	1512	78.60%	0.30%	1.32%	19.78%	NA
Aus	269	17.10%	0.00%	0.00%	82.90%	NA
Indica I	595	98.20%	0.00%	0.00%	1.85%	NA
Indica II	465	71.00%	0.00%	0.00%	29.03%	NA
Indica III	913	90.80%	0.30%	6.46%	2.41%	NA
Indica Intermediate	786	89.30%	0.00%	0.51%	10.18%	NA
Temperate Japonica	767	65.70%	0.40%	2.09%	31.81%	NA
Tropical Japonica	504	96.80%	0.00%	0.20%	2.98%	NA
Japonica Intermediate	241	81.70%	0.40%	1.24%	16.60%	NA
VI/Aromatic	96	91.70%	0.00%	0.00%	8.33%	NA
Intermediate	90	77.80%	1.10%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003005565	C -> T	LOC_Os10g05950.1	upstream_gene_variant ; 4311.0bp to feature; MODIFIER	silent_mutation	Average:40.122; most accessible tissue: Callus, score: 65.104	N	N	N	N
vg1003005565	C -> T	LOC_Os10g05960.1	upstream_gene_variant ; 1378.0bp to feature; MODIFIER	silent_mutation	Average:40.122; most accessible tissue: Callus, score: 65.104	N	N	N	N
vg1003005565	C -> T	LOC_Os10g05960-LOC_Os10g05970	intergenic_region ; MODIFIER	silent_mutation	Average:40.122; most accessible tissue: Callus, score: 65.104	N	N	N	N
vg1003005565	C -> DEL	N	N	silent_mutation	Average:40.122; most accessible tissue: Callus, score: 65.104	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003005565	NA	4.68E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	3.50E-07	NA	mr1219	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	NA	7.60E-06	mr1219	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	NA	6.15E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	NA	4.22E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	NA	3.39E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565	NA	8.08E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251