Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002824620:

Variant ID: vg1002824620 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2824620
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TATGAACACAAGATTGTAAACATCCAAAATTTAGAAAAAAAAACTTAAAATCTAACATTTCAGAATTTTTATCCAGATTTTGAAAGTTTTTATCCTAGGG[A/G]
TATTTTGGTCATTTTGATAAATTTGTACAGTACTAACAAAGACTAACCGAACGGCGATATGGTAAATCGTAGAAGTTAAGCAAAAGTCGATGGTATATTG

Reverse complement sequence

CAATATACCATCGACTTTTGCTTAACTTCTACGATTTACCATATCGCCGTTCGGTTAGTCTTTGTTAGTACTGTACAAATTTATCAAAATGACCAAAATA[T/C]
CCCTAGGATAAAAACTTTCAAAATCTGGATAAAAATTCTGAAATGTTAGATTTTAAGTTTTTTTTTCTAAATTTTGGATGTTTACAATCTTGTGTTCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 46.00% 0.08% 0.23% NA
All Indica  2759 81.80% 17.70% 0.11% 0.40% NA
All Japonica  1512 8.80% 91.10% 0.07% 0.00% NA
Aus  269 10.80% 89.20% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.00% 0.17% NA
Indica II  465 67.70% 31.40% 0.22% 0.65% NA
Indica III  913 76.90% 22.70% 0.22% 0.22% NA
Indica Intermediate  786 83.80% 15.50% 0.00% 0.64% NA
Temperate Japonica  767 11.90% 88.10% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.60% 0.20% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002824620 A -> G LOC_Os10g05650.1 upstream_gene_variant ; 4997.0bp to feature; MODIFIER silent_mutation Average:83.913; most accessible tissue: Minghui63 flower, score: 90.757 N N N N
vg1002824620 A -> G LOC_Os10g05660.1 upstream_gene_variant ; 4531.0bp to feature; MODIFIER silent_mutation Average:83.913; most accessible tissue: Minghui63 flower, score: 90.757 N N N N
vg1002824620 A -> G LOC_Os10g05650-LOC_Os10g05660 intergenic_region ; MODIFIER silent_mutation Average:83.913; most accessible tissue: Minghui63 flower, score: 90.757 N N N N
vg1002824620 A -> DEL N N silent_mutation Average:83.913; most accessible tissue: Minghui63 flower, score: 90.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002824620 A G 0.01 -0.02 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002824620 NA 9.29E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 1.59E-07 1.59E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 9.67E-07 3.27E-07 mr1171 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 1.35E-06 3.51E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 8.47E-06 NA mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 2.71E-07 8.12E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 4.50E-06 4.87E-08 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 6.87E-06 6.87E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 8.78E-06 3.88E-09 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 4.61E-06 4.61E-06 mr1516 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 5.38E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 7.49E-07 7.49E-07 mr1547 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 6.42E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 1.77E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 1.88E-07 1.88E-07 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 2.78E-06 2.78E-06 mr1687 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 1.12E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 4.66E-06 4.66E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 1.17E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 1.36E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 1.84E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 3.40E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824620 NA 6.34E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251