Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002767170:

Variant ID: vg1002767170 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2767170
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCAATGACAGCCCTGCAACGGCTAGAAAACTAGCTGTTGTAGAGTAGTATGGTCTGACCGGCCACATACCTCCGGTCAGACCGGCAGAGCACTGAGTT[G/A]
GGGGATTTCGCCCCCAACGGCTAGTTTTGGTTGGTGGGAGTATAAATACTCCCCCTCCAGCAACAAGGGGATTCTCTTGGCACCCAATTCAATTGCATAC

Reverse complement sequence

GTATGCAATTGAATTGGGTGCCAAGAGAATCCCCTTGTTGCTGGAGGGGGAGTATTTATACTCCCACCAACCAAAACTAGCCGTTGGGGGCGAAATCCCC[C/T]
AACTCAGTGCTCTGCCGGTCTGACCGGAGGTATGTGGCCGGTCAGACCATACTACTCTACAACAGCTAGTTTTCTAGCCGTTGCAGGGCTGTCATTGGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 19.40% 2.37% 0.04% NA
All Indica  2759 94.20% 5.20% 0.58% 0.00% NA
All Japonica  1512 59.60% 40.10% 0.33% 0.00% NA
Aus  269 34.20% 56.50% 9.29% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 88.20% 10.80% 0.99% 0.00% NA
Indica Intermediate  786 94.90% 4.30% 0.76% 0.00% NA
Temperate Japonica  767 87.70% 11.90% 0.39% 0.00% NA
Tropical Japonica  504 14.10% 85.90% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 34.00% 0.83% 0.00% NA
VI/Aromatic  96 37.50% 0.00% 60.42% 2.08% NA
Intermediate  90 73.30% 17.80% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002767170 G -> A LOC_Os10g05570.1 upstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1002767170 G -> A LOC_Os10g05570-LOC_Os10g05580 intergenic_region ; MODIFIER silent_mutation Average:69.632; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1002767170 G -> DEL N N silent_mutation Average:69.632; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002767170 G A -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002767170 NA 1.59E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 7.82E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.14E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.66E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 7.46E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 2.04E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 4.46E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.34E-09 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 2.45E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.34E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.04E-06 mr1292 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.20E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 8.07E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 2.98E-06 mr1415 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.88E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.57E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.34E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 7.03E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 2.98E-06 mr1567 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 3.65E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 4.51E-07 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 9.89E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 4.17E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.13E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 6.29E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 5.45E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.93E-09 mr1825 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 8.57E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 8.60E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.59E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 4.37E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.35E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 1.82E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002767170 NA 2.31E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251