Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002758363:

Variant ID: vg1002758363 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2758363
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGTAGACTGAACACCCACACAATCTCAATTTGACACAGCAACACTTTCCACCTCTCTTCCTTCCCTTGGATCAGATAGGAAATCCTCACTTTTCCAAG[A/G]
CAGAAGAGAAGCAAGCAACGGATTGAGCAACTAGCGTGAAAGAACAAGGGATGAGCGCTTTGTTGCTAAAGCGCATACGTTTTCTTGCTTGATTTTTATA

Reverse complement sequence

TATAAAAATCAAGCAAGAAAACGTATGCGCTTTAGCAACAAAGCGCTCATCCCTTGTTCTTTCACGCTAGTTGCTCAATCCGTTGCTTGCTTCTCTTCTG[T/C]
CTTGGAAAAGTGAGGATTTCCTATCTGATCCAAGGGAAGGAAGAGAGGTGGAAAGTGTTGCTGTGTCAAATTGAGATTGTGTGGGTGTTCAGTCTACCGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	20.80%	0.36%	3.41%	NA
All Indica	2759	90.30%	7.00%	0.22%	2.46%	NA
All Japonica	1512	59.50%	40.40%	0.07%	0.07%	NA
Aus	269	29.00%	58.70%	1.12%	11.15%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	97.80%	1.30%	0.00%	0.86%	NA
Indica III	913	80.50%	13.40%	0.11%	6.02%	NA
Indica Intermediate	786	91.00%	7.30%	0.64%	1.15%	NA
Temperate Japonica	767	87.50%	12.50%	0.00%	0.00%	NA
Tropical Japonica	504	13.90%	85.90%	0.20%	0.00%	NA
Japonica Intermediate	241	65.60%	34.00%	0.00%	0.41%	NA
VI/Aromatic	96	34.40%	0.00%	6.25%	59.38%	NA
Intermediate	90	70.00%	23.30%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002758363	A -> G	LOC_Os10g05560.1	downstream_gene_variant ; 2250.0bp to feature; MODIFIER	silent_mutation	Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg1002758363	A -> G	LOC_Os10g05550-LOC_Os10g05560	intergenic_region ; MODIFIER	silent_mutation	Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg1002758363	A -> DEL	N	N	silent_mutation	Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002758363	NA	7.08E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	7.47E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.79E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.48E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	6.53E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	9.30E-10	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	6.24E-06	mr1292	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.68E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.46E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.09E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.46E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	4.48E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.07E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.43E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	4.48E-13	mr1580	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.34E-10	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.75E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.80E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.01E-11	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.62E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	4.26E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.04E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.21E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	4.18E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	3.54E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.02E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	1.98E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002758363	NA	2.02E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251