Variant ID: vg1002297395 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 2297395 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )
TCACAAGTTTACAGCAGAAAAAAAAGCATAATAATGTATATAGTAAATCACTAAATATGCCCAAACTGAAAATGACCCAAAAATTTGTTGCACACCAAGC[G/A]
GCATTGCAACTACAATATTGTTAGTCTTGCACAGCGATCTAATGCAATGAAAACTGGGAGTGTACTCTAGAAACAGTACGACTTGCCAATGCACCCCCTT
AAGGGGGTGCATTGGCAAGTCGTACTGTTTCTAGAGTACACTCCCAGTTTTCATTGCATTAGATCGCTGTGCAAGACTAACAATATTGTAGTTGCAATGC[C/T]
GCTTGGTGTGCAACAAATTTTTGGGTCATTTTCAGTTTGGGCATATTTAGTGATTTACTATATACATTATTATGCTTTTTTTTCTGCTGTAAACTTGTGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.00% | 7.60% | 0.47% | 0.00% | NA |
All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 77.30% | 21.40% | 1.32% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 92.80% | 5.90% | 1.30% | 0.00% | NA |
Tropical Japonica | 504 | 47.40% | 50.80% | 1.79% | 0.00% | NA |
Japonica Intermediate | 241 | 90.50% | 9.10% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1002297395 | G -> A | LOC_Os10g04770.1 | upstream_gene_variant ; 4627.0bp to feature; MODIFIER | silent_mutation | Average:60.417; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
vg1002297395 | G -> A | LOC_Os10g04780.1 | downstream_gene_variant ; 2043.0bp to feature; MODIFIER | silent_mutation | Average:60.417; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
vg1002297395 | G -> A | LOC_Os10g04770-LOC_Os10g04780 | intergenic_region ; MODIFIER | silent_mutation | Average:60.417; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1002297395 | NA | 3.36E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1002297395 | NA | 6.02E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1002297395 | 9.49E-08 | NA | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1002297395 | NA | 1.46E-08 | mr1758_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1002297395 | NA | 1.86E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1002297395 | NA | 1.35E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |