Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002297086:

Variant ID: vg1002297086 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2297086
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAAGCCAGCAAATTCATTTGTCACTATCAGTCACACAATTTAACAAATTTCACAAACATCAGAGTTCAAAGCCTGGATCAAGCTGTGATGATAATGAC[G/A]
ACTTCAACGAAACAAATAACTGCATGTCTGTTCTGGGTTTAAAACCCATAAGAAACATGTGTTCAGCTGCGCACATCAGCCTAATTAGTGCTATGACTGA

Reverse complement sequence

TCAGTCATAGCACTAATTAGGCTGATGTGCGCAGCTGAACACATGTTTCTTATGGGTTTTAAACCCAGAACAGACATGCAGTTATTTGTTTCGTTGAAGT[C/T]
GTCATTATCATCACAGCTTGATCCAGGCTTTGAACTCTGATGTTTGTGAAATTTGTTAAATTGTGTGACTGATAGTGACAAATGAATTTGCTGGCTTGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.50%	36.50%	0.02%	0.00%	NA
All Indica	2759	86.40%	13.60%	0.00%	0.00%	NA
All Japonica	1512	16.50%	83.50%	0.07%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	67.20%	32.80%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	89.40%	10.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.70%	9.30%	0.00%	0.00%	NA
Temperate Japonica	767	8.90%	91.00%	0.13%	0.00%	NA
Tropical Japonica	504	24.40%	75.60%	0.00%	0.00%	NA
Japonica Intermediate	241	24.10%	75.90%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002297086	G -> A	LOC_Os10g04770.1	upstream_gene_variant ; 4318.0bp to feature; MODIFIER	silent_mutation	Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg1002297086	G -> A	LOC_Os10g04780.1	downstream_gene_variant ; 2352.0bp to feature; MODIFIER	silent_mutation	Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg1002297086	G -> A	LOC_Os10g04770-LOC_Os10g04780	intergenic_region ; MODIFIER	silent_mutation	Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002297086	NA	6.39E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	7.14E-06	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	NA	8.04E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	NA	2.14E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	NA	1.82E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	NA	3.88E-10	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086	2.95E-07	6.46E-15	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251