Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002287752:

Variant ID: vg1002287752 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2287752
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTTAGTGTGAAACATATTGATAAGTATATGTTAAATATTGTAAAAGTGATAAATAGATTTGTTAAAATATAGTGCAAATGACATGAGGGGGTGATGAT[T/C]
GGATATGTTTGCATTTTGATTTGTAGAATTAAATAAATGAGTAAATTTCATAAAACTAAACTACAGATTTTAGAACTAGTTTCATAAAACTACAGATTTA

Reverse complement sequence

TAAATCTGTAGTTTTATGAAACTAGTTCTAAAATCTGTAGTTTAGTTTTATGAAATTTACTCATTTATTTAATTCTACAAATCAAAATGCAAACATATCC[A/G]
ATCATCACCCCCTCATGTCATTTGCACTATATTTTAACAAATCTATTTATCACTTTTACAATATTTAACATATACTTATCAATATGTTTCACACTAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	1.60%	0.74%	61.83%	NA
All Indica	2759	12.60%	2.50%	1.23%	83.69%	NA
All Japonica	1512	83.50%	0.10%	0.00%	16.40%	NA
Aus	269	12.30%	1.90%	0.37%	85.50%	NA
Indica I	595	28.60%	5.20%	1.51%	64.71%	NA
Indica II	465	2.40%	1.10%	1.08%	95.48%	NA
Indica III	913	9.10%	2.70%	0.77%	87.40%	NA
Indica Intermediate	786	10.70%	0.90%	1.65%	86.77%	NA
Temperate Japonica	767	91.10%	0.00%	0.00%	8.87%	NA
Tropical Japonica	504	76.20%	0.00%	0.00%	23.81%	NA
Japonica Intermediate	241	74.70%	0.40%	0.00%	24.90%	NA
VI/Aromatic	96	14.60%	2.10%	0.00%	83.33%	NA
Intermediate	90	38.90%	0.00%	0.00%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002287752	T -> C	LOC_Os10g04770.1	downstream_gene_variant ; 1430.0bp to feature; MODIFIER	silent_mutation	Average:14.939; most accessible tissue: Callus, score: 25.642	N	N	N	N
vg1002287752	T -> C	LOC_Os10g04760-LOC_Os10g04770	intergenic_region ; MODIFIER	silent_mutation	Average:14.939; most accessible tissue: Callus, score: 25.642	N	N	N	N
vg1002287752	T -> DEL	N	N	silent_mutation	Average:14.939; most accessible tissue: Callus, score: 25.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002287752	1.20E-08	NA	mr1486	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752	7.30E-06	NA	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752	9.73E-07	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752	9.66E-06	9.32E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752	1.03E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752	NA	3.16E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251