Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002265718:

Variant ID: vg1002265718 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2265718
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCAAAATCTAAATCTCATGAAAAGACTATAATACATACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAACATGCACAAGAAAATACCA[T/C]
ATGTATAAACAAAGCTCTCTTTTCTCAATTTTTCTCATTGTCATATTTTTGCTTGATAAAACCATAAGGTACAAACTCCCCCTCAAACCATGCCAAAAGG

Reverse complement sequence

CCTTTTGGCATGGTTTGAGGGGGAGTTTGTACCTTATGGTTTTATCAAGCAAAAATATGACAATGAGAAAAATTGAGAAAAGAGAGCTTTGTTTATACAT[A/G]
TGGTATTTTCTTGTGCATGTTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGTATGTATTATAGTCTTTTCATGAGATTTAGATTTTGCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	0.80%	4.55%	18.26%	NA
All Indica	2759	66.90%	1.20%	6.78%	25.12%	NA
All Japonica	1512	91.50%	0.00%	0.66%	7.80%	NA
Aus	269	77.00%	3.00%	5.95%	14.13%	NA
Indica I	595	69.70%	0.00%	5.55%	24.71%	NA
Indica II	465	57.80%	0.60%	10.54%	30.97%	NA
Indica III	913	69.10%	2.70%	6.35%	21.80%	NA
Indica Intermediate	786	67.70%	0.50%	5.98%	25.83%	NA
Temperate Japonica	767	93.60%	0.00%	0.00%	6.39%	NA
Tropical Japonica	504	91.50%	0.00%	1.59%	6.94%	NA
Japonica Intermediate	241	85.10%	0.00%	0.83%	14.11%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	0.00%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002265718	T -> C	LOC_Os10g04730.1	downstream_gene_variant ; 3092.0bp to feature; MODIFIER	silent_mutation	Average:7.872; most accessible tissue: Callus, score: 13.703	N	N	N	N
vg1002265718	T -> C	LOC_Os10g04740.1	downstream_gene_variant ; 253.0bp to feature; MODIFIER	silent_mutation	Average:7.872; most accessible tissue: Callus, score: 13.703	N	N	N	N
vg1002265718	T -> C	LOC_Os10g04730-LOC_Os10g04740	intergenic_region ; MODIFIER	silent_mutation	Average:7.872; most accessible tissue: Callus, score: 13.703	N	N	N	N
vg1002265718	T -> DEL	N	N	silent_mutation	Average:7.872; most accessible tissue: Callus, score: 13.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002265718	9.29E-11	2.59E-33	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	5.46E-06	2.35E-18	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	1.06E-08	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	8.66E-06	7.36E-10	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	1.86E-11	7.20E-33	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	1.88E-07	2.88E-19	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	1.39E-10	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265718	1.79E-07	3.85E-15	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251