Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002208168:

Variant ID: vg1002208168 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2208168
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCCAAAAAAATGGAGGGTCTGAACCATTTGCTAAACGGGGCCTGAATGCCTAGCTTTGCACACTGGCTATTACTATCTCGTTATTTAGCTCCAGAATG[T/C]
ATAAGAGAAAGATCAATAGTGTAGCCAGCAGCTGGCTCCACTTACCTTTATACTATTATTTTATAGCTAATACTAAAATCAACCAGTACAATAGATTAGC

Reverse complement sequence

GCTAATCTATTGTACTGGTTGATTTTAGTATTAGCTATAAAATAATAGTATAAAGGTAAGTGGAGCCAGCTGCTGGCTACACTATTGATCTTTCTCTTAT[A/G]
CATTCTGGAGCTAAATAACGAGATAGTAATAGCCAGTGTGCAAAGCTAGGCATTCAGGCCCCGTTTAGCAAATGGTTCAGACCCTCCATTTTTTTGGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.40%	18.70%	0.89%	59.01%	NA
All Indica	2759	1.60%	14.40%	0.80%	83.22%	NA
All Japonica	1512	62.00%	22.40%	0.07%	15.48%	NA
Aus	269	0.00%	15.20%	4.83%	79.93%	NA
Indica I	595	0.70%	27.40%	0.67%	71.26%	NA
Indica II	465	0.60%	2.60%	0.43%	96.34%	NA
Indica III	913	1.90%	15.80%	1.10%	81.27%	NA
Indica Intermediate	786	2.50%	9.90%	0.76%	86.77%	NA
Temperate Japonica	767	58.70%	32.30%	0.13%	8.87%	NA
Tropical Japonica	504	74.20%	4.00%	0.00%	21.83%	NA
Japonica Intermediate	241	47.30%	29.50%	0.00%	23.24%	NA
VI/Aromatic	96	9.40%	85.40%	3.12%	2.08%	NA
Intermediate	90	21.10%	28.90%	3.33%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002208168	T -> C	LOC_Os10g04630.1	upstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N
vg1002208168	T -> C	LOC_Os10g04620.1	downstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N
vg1002208168	T -> C	LOC_Os10g04625.1	downstream_gene_variant ; 280.0bp to feature; MODIFIER	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N
vg1002208168	T -> C	LOC_Os10g04620.2	downstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N
vg1002208168	T -> C	LOC_Os10g04620-LOC_Os10g04625	intergenic_region ; MODIFIER	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N
vg1002208168	T -> DEL	N	N	silent_mutation	Average:13.0; most accessible tissue: Callus, score: 64.654	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002208168	NA	1.48E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002208168	NA	1.85E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002208168	3.21E-06	2.56E-12	mr1676_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002208168	NA	9.25E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251