Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002006293:

Variant ID: vg1002006293 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2006293
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGTCGCGCATTGGACATTTCAGGGTGTGTTTAGCTGGCGAAAAGAAAATTTTTATGCGTTATATTGGACGTTTGACCGGATGTCGGAAGGAGTTTTTGA[C/T]
ACGAATGAAAAAATTAATTTTATAACTCGTCTGAAAACCACGAAACGAATTTATTAAGCCTGATTAATCTATCATTAGCACGTAAGAGTTATTATGGCAC

Reverse complement sequence

GTGCCATAATAACTCTTACGTGCTAATGATAGATTAATCAGGCTTAATAAATTCGTTTCGTGGTTTTCAGACGAGTTATAAAATTAATTTTTTCATTCGT[G/A]
TCAAAAACTCCTTCCGACATCCGGTCAAACGTCCAATATAACGCATAAAAATTTTCTTTTCGCCAGCTAAACACACCCTGAAATGTCCAATGCGCGACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	2.20%	1.02%	11.19%	NA
All Indica	2759	83.60%	0.00%	0.87%	15.51%	NA
All Japonica	1512	91.30%	6.70%	1.46%	0.60%	NA
Aus	269	67.70%	0.00%	0.74%	31.60%	NA
Indica I	595	83.00%	0.00%	1.34%	15.63%	NA
Indica II	465	87.50%	0.00%	1.51%	10.97%	NA
Indica III	913	79.40%	0.00%	0.44%	20.15%	NA
Indica Intermediate	786	86.50%	0.10%	0.64%	12.72%	NA
Temperate Japonica	767	95.20%	2.90%	1.17%	0.78%	NA
Tropical Japonica	504	84.50%	13.10%	2.18%	0.20%	NA
Japonica Intermediate	241	92.90%	5.40%	0.83%	0.83%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	93.30%	2.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002006293	C -> T	LOC_Os10g04280.1	upstream_gene_variant ; 4706.0bp to feature; MODIFIER	silent_mutation	Average:57.886; most accessible tissue: Minghui63 root, score: 95.988	N	N	N	N
vg1002006293	C -> T	LOC_Os10g04270-LOC_Os10g04280	intergenic_region ; MODIFIER	silent_mutation	Average:57.886; most accessible tissue: Minghui63 root, score: 95.988	N	N	N	N
vg1002006293	C -> DEL	N	N	silent_mutation	Average:57.886; most accessible tissue: Minghui63 root, score: 95.988	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1002006293	C	T	-0.04	-0.02	-0.03	-0.02	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002006293	NA	2.78E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	1.03E-06	1.03E-06	mr1424_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	NA	4.14E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	NA	1.65E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	NA	4.99E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	6.99E-06	6.99E-06	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293	NA	1.42E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251