| Variant ID: vg1001790681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1790681 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 107. )
TTTTGCCTATTTATTTTTCATTTACGTGATTTCAGCTGCACAGCCCGTGATAACTGTGCGAATATCGCGGTTAACCATGCGGTAACCACAGCGAAGCCGC[G/A]
AAACCACCGAGTTTTGAATTCGAATTTTTGGATGCGATTTTCGGCGGTTACCGCGCTACTGGGTGTGTGTGTGTGTGGGGGGGGGGGAAGGGGTAACCCT
AGGGTTACCCCTTCCCCCCCCCCCACACACACACACACCCAGTAGCGCGGTAACCGCCGAAAATCGCATCCAAAAATTCGAATTCAAAACTCGGTGGTTT[C/T]
GCGGCTTCGCTGTGGTTACCGCATGGTTAACCGCGATATTCGCACAGTTATCACGGGCTGTGCAGCTGAAATCACGTAAATGAAAAATAAATAGGCAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 17.90% | 0.42% | 30.22% | NA |
| All Indica | 2759 | 29.60% | 19.40% | 0.69% | 50.31% | NA |
| All Japonica | 1512 | 94.40% | 4.00% | 0.00% | 1.59% | NA |
| Aus | 269 | 12.60% | 87.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 46.70% | 2.90% | 0.67% | 49.75% | NA |
| Indica II | 465 | 22.60% | 14.80% | 1.08% | 61.51% | NA |
| Indica III | 913 | 22.00% | 32.00% | 0.44% | 45.56% | NA |
| Indica Intermediate | 786 | 29.60% | 20.00% | 0.76% | 49.62% | NA |
| Temperate Japonica | 767 | 99.10% | 0.10% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 85.30% | 11.50% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 13.30% | 1.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001790681 | G -> A | LOC_Os10g03930.1 | upstream_gene_variant ; 2602.0bp to feature; MODIFIER | silent_mutation | Average:31.774; most accessible tissue: Callus, score: 66.348 | N | N | N | N |
| vg1001790681 | G -> A | LOC_Os10g03950.1 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:31.774; most accessible tissue: Callus, score: 66.348 | N | N | N | N |
| vg1001790681 | G -> A | LOC_Os10g03930-LOC_Os10g03950 | intergenic_region ; MODIFIER | silent_mutation | Average:31.774; most accessible tissue: Callus, score: 66.348 | N | N | N | N |
| vg1001790681 | G -> DEL | N | N | silent_mutation | Average:31.774; most accessible tissue: Callus, score: 66.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001790681 | 1.82E-06 | NA | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001790681 | 1.91E-06 | NA | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001790681 | 7.05E-07 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001790681 | 1.85E-07 | 6.90E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |