Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001527825:

Variant ID: vg1001527825 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1527825
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCTAGAGTGTCCCTCTTATTCGAGACGCATGCGAATTAATTGGGCCGCACCTTTTCACGTGCCCCTTACCTCACGCACCAATCGGGCGTGCATGAGAC[C/T]
GTTTTCCACACGCACCTTTGCGCGCCACCGCGATTGGGCCCGCAACACCCTCGCGCACACGATTTTCCGCATGCCCAATTGGGCCCGCGACGCTCTCACG

Reverse complement sequence

CGTGAGAGCGTCGCGGGCCCAATTGGGCATGCGGAAAATCGTGTGCGCGAGGGTGTTGCGGGCCCAATCGCGGTGGCGCGCAAAGGTGCGTGTGGAAAAC[G/A]
GTCTCATGCACGCCCGATTGGTGCGTGAGGTAAGGGGCACGTGAAAAGGTGCGGCCCAATTAATTCGCATGCGTCTCGAATAAGAGGGACACTCTAGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	33.30%	1.02%	1.14%	NA
All Indica	2759	41.00%	55.30%	1.67%	1.96%	NA
All Japonica	1512	99.00%	1.00%	0.00%	0.00%	NA
Aus	269	96.70%	2.60%	0.74%	0.00%	NA
Indica I	595	42.40%	57.00%	0.50%	0.17%	NA
Indica II	465	32.90%	63.70%	1.72%	1.72%	NA
Indica III	913	43.70%	49.60%	2.63%	4.05%	NA
Indica Intermediate	786	41.70%	55.90%	1.40%	1.02%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001527825	C -> T	LOC_Os10g03530.1	upstream_gene_variant ; 1531.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03540.1	upstream_gene_variant ; 2734.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03550.1	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03550.2	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03550.3	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03520.1	downstream_gene_variant ; 3388.0bp to feature; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> T	LOC_Os10g03530-LOC_Os10g03540	intergenic_region ; MODIFIER	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1001527825	C -> DEL	N	N	silent_mutation	Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001527825	NA	2.80E-06	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	7.62E-12	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	8.51E-13	2.63E-14	mr1486	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	1.05E-10	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	2.29E-10	5.96E-11	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	5.27E-06	3.56E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	8.96E-06	NA	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	NA	2.43E-06	mr1721	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	2.84E-10	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	3.53E-11	7.92E-13	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	7.42E-06	NA	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	3.93E-09	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825	1.57E-08	4.28E-10	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251