Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001438740:

Variant ID: vg1001438740 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1438740
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAGCCAAGCTCATGGAGCTCCCTCCCTCCCCTCCCAATTCCAATTGGCCCTCGCCGCCTCCGCTCACCGAGAGAGGGCAGCGAAGGGGGAGAGGAAAA[A/G]
GAGCAGTGATGACAACTGGGCCCTAATTTGCAAAATGATTACACGACATATAGATCACCCATCCAACACTAGACGATTTGATTTCCTCCAACCAAACAAC

Reverse complement sequence

GTTGTTTGGTTGGAGGAAATCAAATCGTCTAGTGTTGGATGGGTGATCTATATGTCGTGTAATCATTTTGCAAATTAGGGCCCAGTTGTCATCACTGCTC[T/C]
TTTTCCTCTCCCCCTTCGCTGCCCTCTCTCGGTGAGCGGAGGCGGCGAGGGCCAATTGGAATTGGGAGGGGAGGGAGGGAGCTCCATGAGCTTGGCTAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	10.00%	0.04%	0.91%	NA
All Indica	2759	85.30%	13.70%	0.04%	0.98%	NA
All Japonica	1512	99.70%	0.10%	0.07%	0.13%	NA
Aus	269	65.80%	32.00%	0.00%	2.23%	NA
Indica I	595	85.50%	14.30%	0.00%	0.17%	NA
Indica II	465	95.30%	4.50%	0.00%	0.22%	NA
Indica III	913	78.10%	19.50%	0.00%	2.41%	NA
Indica Intermediate	786	87.70%	11.80%	0.13%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	88.90%	10.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001438740	A -> G	LOC_Os10g03370.1	downstream_gene_variant ; 2046.0bp to feature; MODIFIER	silent_mutation	Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg1001438740	A -> G	LOC_Os10g03380.1	intron_variant ; MODIFIER	silent_mutation	Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg1001438740	A -> DEL	N	N	silent_mutation	Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001438740	2.64E-06	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	8.01E-09	1.07E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	1.79E-08	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	1.47E-09	2.35E-08	mr1548	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	9.97E-07	NA	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	1.24E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	4.48E-11	4.15E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	2.47E-07	NA	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740	2.60E-12	1.79E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251