Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001393119:

Variant ID: vg1001393119 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1393119
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, G: 0.11, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CACAAACTAGAATAAGAGGGAAAGCAAAGCAAGTAGAGAGTGAGTAAACCGGTCTTAATGAGATAAGAATAATGCATTGATAGAGGATGAGAGGAGTCCG[C/G]
TAGGCCTTACTATTTGTCACCATAGGGCATATTGAGTAAAGGCCAGTGCAAGTGGATTGTACAGTGACCAAACAAATTCGATGCTACAAATGCAAAAATC

Reverse complement sequence

GATTTTTGCATTTGTAGCATCGAATTTGTTTGGTCACTGTACAATCCACTTGCACTGGCCTTTACTCAATATGCCCTATGGTGACAAATAGTAAGGCCTA[G/C]
CGGACTCCTCTCATCCTCTATCAATGCATTATTCTTATCTCATTAAGACCGGTTTACTCACTCTCTACTTGCTTTGCTTTCCCTCTTATTCTAGTTTGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	32.80%	5.33%	11.53%	NA
All Indica	2759	72.40%	23.10%	1.05%	3.41%	NA
All Japonica	1512	6.50%	54.80%	12.04%	26.72%	NA
Aus	269	93.70%	4.10%	2.23%	0.00%	NA
Indica I	595	96.00%	2.50%	0.34%	1.18%	NA
Indica II	465	60.90%	36.10%	1.08%	1.94%	NA
Indica III	913	61.70%	32.60%	0.99%	4.71%	NA
Indica Intermediate	786	73.90%	20.00%	1.65%	4.45%	NA
Temperate Japonica	767	0.80%	79.90%	8.60%	10.69%	NA
Tropical Japonica	504	16.50%	24.40%	12.50%	46.63%	NA
Japonica Intermediate	241	3.70%	38.20%	21.99%	36.10%	NA
VI/Aromatic	96	5.20%	34.40%	25.00%	35.42%	NA
Intermediate	90	31.10%	42.20%	12.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001393119	C -> G	LOC_Os10g03300.1	upstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg1001393119	C -> G	LOC_Os10g03280.1	downstream_gene_variant ; 3933.0bp to feature; MODIFIER	silent_mutation	Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg1001393119	C -> G	LOC_Os10g03290.1	downstream_gene_variant ; 1290.0bp to feature; MODIFIER	silent_mutation	Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg1001393119	C -> G	LOC_Os10g03290-LOC_Os10g03300	intergenic_region ; MODIFIER	silent_mutation	Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg1001393119	C -> DEL	N	N	silent_mutation	Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1001393119	C	G	0.01	-0.01	-0.01	0.02	0.02	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001393119	NA	6.68E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	1.61E-14	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	4.27E-22	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	8.99E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	1.74E-30	mr1495	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	1.49E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	6.09E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	2.11E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	2.73E-27	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	6.74E-15	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	8.80E-28	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	4.40E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	2.70E-30	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	1.91E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	8.06E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119	NA	1.15E-26	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251