Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001306734:

Variant ID: vg1001306734 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1306734
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:

AGTCGTTCAAGATTCTTTACAGACAAAATTAAAGGCGTTTGATGTGAAGAGCTTGGGCTGAGTTTAGTTCCAAACTTTTTCTTTAAACTTTCAACTTTTT[C/T]
ATCACATCAAAATTTTTTTATACACTCAAACATTCAATTTTTCCATCACATCATTTCAATTTCAACCAAACTTTTAATTTTGGCGTGAACTAAACACACC

Reverse complement sequence

GGTGTGTTTAGTTCACGCCAAAATTAAAAGTTTGGTTGAAATTGAAATGATGTGATGGAAAAATTGAATGTTTGAGTGTATAAAAAAATTTTGATGTGAT[G/A]
AAAAAGTTGAAAGTTTAAAGAAAAAGTTTGGAACTAAACTCAGCCCAAGCTCTTCACATCAAACGCCTTTAATTTTGTCTGTAAAGAATCTTGAACGACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.20%	25.50%	0.99%	33.31%	NA
All Indica	2759	57.30%	8.40%	1.12%	33.13%	NA
All Japonica	1512	8.10%	54.30%	0.66%	36.97%	NA
Aus	269	58.40%	35.30%	0.37%	5.95%	NA
Indica I	595	62.70%	11.60%	3.03%	22.69%	NA
Indica II	465	42.60%	6.70%	1.94%	48.82%	NA
Indica III	913	55.50%	8.90%	0.11%	35.49%	NA
Indica Intermediate	786	64.00%	6.60%	0.38%	29.01%	NA
Temperate Japonica	767	0.90%	85.10%	0.52%	13.43%	NA
Tropical Japonica	504	20.00%	15.50%	0.60%	63.89%	NA
Japonica Intermediate	241	5.80%	37.30%	1.24%	55.60%	NA
VI/Aromatic	96	6.20%	30.20%	3.12%	60.42%	NA
Intermediate	90	36.70%	31.10%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001306734	C -> T	LOC_Os10g03100.1	upstream_gene_variant ; 1680.0bp to feature; MODIFIER	silent_mutation	Average:56.59; most accessible tissue: Callus, score: 98.28	N	N	N	N
vg1001306734	C -> T	LOC_Os10g03110.1	downstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:56.59; most accessible tissue: Callus, score: 98.28	N	N	N	N
vg1001306734	C -> T	LOC_Os10g03090-LOC_Os10g03100	intergenic_region ; MODIFIER	silent_mutation	Average:56.59; most accessible tissue: Callus, score: 98.28	N	N	N	N
vg1001306734	C -> DEL	N	N	silent_mutation	Average:56.59; most accessible tissue: Callus, score: 98.28	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001306734	2.48E-10	2.45E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	3.13E-11	3.82E-12	mr1486	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	1.22E-07	1.93E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	1.25E-09	1.85E-10	mr1548	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	NA	1.01E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	1.27E-06	5.61E-07	mr1588	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	NA	1.08E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	7.09E-09	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	1.09E-10	3.03E-11	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734	6.86E-10	6.21E-11	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251