Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001247771:

Variant ID: vg1001247771 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1247771
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCAACATTGCATATTTGCTTAATTCAAGTAGAATTTAAGTGTCATGCATCATCTCCTTAAAAGCAAAATCTAAATCTTATGAAAAAGACTAGAATACA[T/C]
ACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAGCATGCACAAGAAAATACTATATGTATAAACAAAGCTCTCTTTTTCTCAATTTTCCTC

Reverse complement sequence

GAGGAAAATTGAGAAAAAGAGAGCTTTGTTTATACATATAGTATTTTCTTGTGCATGCTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGT[A/G]
TGTATTCTAGTCTTTTTCATAAGATTTAGATTTTGCTTTTAAGGAGATGATGCATGACACTTAAATTCTACTTGAATTAAGCAAATATGCAATGTTGATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	1.90%	9.46%	19.95%	NA
All Indica	2759	74.80%	0.30%	9.28%	15.66%	NA
All Japonica	1512	55.40%	3.20%	9.46%	31.94%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	64.50%	0.00%	10.08%	25.38%	NA
Indica II	465	61.10%	0.00%	12.04%	26.88%	NA
Indica III	913	86.60%	0.90%	7.01%	5.48%	NA
Indica Intermediate	786	76.80%	0.00%	9.67%	13.49%	NA
Temperate Japonica	767	74.30%	2.10%	4.30%	19.30%	NA
Tropical Japonica	504	37.30%	3.00%	12.70%	47.02%	NA
Japonica Intermediate	241	33.20%	7.10%	19.09%	40.66%	NA
VI/Aromatic	96	18.80%	30.20%	35.42%	15.62%	NA
Intermediate	90	66.70%	5.60%	15.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001247771	T -> C	LOC_Os10g02990.1	upstream_gene_variant ; 2111.0bp to feature; MODIFIER	silent_mutation	Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N
vg1001247771	T -> C	LOC_Os10g03000.1	downstream_gene_variant ; 147.0bp to feature; MODIFIER	silent_mutation	Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N
vg1001247771	T -> C	LOC_Os10g03010.1	downstream_gene_variant ; 2931.0bp to feature; MODIFIER	silent_mutation	Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N
vg1001247771	T -> C	LOC_Os10g02990-LOC_Os10g03000	intergenic_region ; MODIFIER	silent_mutation	Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N
vg1001247771	T -> DEL	N	N	silent_mutation	Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001247771	3.64E-06	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	NA	6.42E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	7.39E-08	7.35E-08	mr1197_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	3.05E-07	3.05E-07	mr1197_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	NA	2.97E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	1.93E-06	NA	mr1543_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	8.30E-09	NA	mr1680_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	1.55E-06	NA	mr1680_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771	1.33E-07	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251