Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001115932:

Variant ID: vg1001115932 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1115932
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTCATGTTCTTGTGTGTTTGTGCTCGGCCAAGGTTTAGGGATGGGAATTGCATTTTTGATGGTAAGATTGGTTGTTTTCCACTTGTTACTTATGAACC[G/A]
GCTAGAAGAGGTAATGAGAGAACCGGCCGTGTCCGTGGAGACTTGGTTATGAAGCCCATAACTTCGATCACAAGAGACGTGATTAGAGATTTCATGATCA

Reverse complement sequence

TGATCATGAAATCTCTAATCACGTCTCTTGTGATCGAAGTTATGGGCTTCATAACCAAGTCTCCACGGACACGGCCGGTTCTCTCATTACCTCTTCTAGC[C/T]
GGTTCATAAGTAACAAGTGGAAAACAACCAATCTTACCATCAAAAATGCAATTCCCATCCCTAAACCTTGGCCGAGCACAAACACACAAGAACATGAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 17.80% 0.17% 1.71% NA
All Indica  2759 99.20% 0.50% 0.00% 0.25% NA
All Japonica  1512 47.00% 49.50% 0.40% 3.11% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.30% 0.00% 0.76% NA
Temperate Japonica  767 68.60% 31.30% 0.00% 0.13% NA
Tropical Japonica  504 24.40% 67.90% 0.40% 7.34% NA
Japonica Intermediate  241 25.70% 68.90% 1.66% 3.73% NA
VI/Aromatic  96 17.70% 59.40% 1.04% 21.88% NA
Intermediate  90 71.10% 22.20% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001115932 G -> A LOC_Os10g02790.1 synonymous_variant ; p.Pro189Pro; LOW synonymous_codon Average:57.02; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1001115932 G -> DEL LOC_Os10g02790.1 N frameshift_variant Average:57.02; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001115932 NA 3.58E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1001115932 NA 3.72E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 2.17E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 9.07E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 4.20E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 9.17E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 3.81E-11 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 4.24E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 1.73E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 1.72E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 4.85E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 7.30E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 4.85E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 7.55E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 7.70E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 7.16E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 2.07E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 6.07E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 2.13E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 9.27E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 1.51E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 5.44E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 3.27E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 3.74E-06 1.01E-06 mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 4.33E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 2.72E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001115932 NA 1.76E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251