Variant ID: vg1001004126 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 1004126 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCAATCGTTGATTTTACTCCAGCCAGATTTGTATATTAAGTTACAATCAATGTACAATTATGATAAAATCTCCCAGATAATTCCGTTCACAATCTATCTA[A/G]
TTAATGCGTGGGCGTTTCGATATGATCCAAAGATATCTCACATCTATTTCGTCTATAAATGCAAAATTAATTGTAATATACTATATATATTCGTCGGCCA
TGGCCGACGAATATATATAGTATATTACAATTAATTTTGCATTTATAGACGAAATAGATGTGAGATATCTTTGGATCATATCGAAACGCCCACGCATTAA[T/C]
TAGATAGATTGTGAACGGAATTATCTGGGAGATTTTATCATAATTGTACATTGATTGTAACTTAATATACAAATCTGGCTGGAGTAAAATCAACGATTGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.00% | 0.60% | 0.32% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 97.40% | 2.00% | 0.66% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 95.70% | 3.40% | 0.91% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1001004126 | A -> G | LOC_Os10g02620.1 | upstream_gene_variant ; 1219.0bp to feature; MODIFIER | silent_mutation | Average:52.253; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
vg1001004126 | A -> G | LOC_Os10g02625.1 | upstream_gene_variant ; 150.0bp to feature; MODIFIER | silent_mutation | Average:52.253; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
vg1001004126 | A -> G | LOC_Os10g02610.1 | downstream_gene_variant ; 4675.0bp to feature; MODIFIER | silent_mutation | Average:52.253; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
vg1001004126 | A -> G | LOC_Os10g02630.1 | downstream_gene_variant ; 3460.0bp to feature; MODIFIER | silent_mutation | Average:52.253; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
vg1001004126 | A -> G | LOC_Os10g02620-LOC_Os10g02625 | intergenic_region ; MODIFIER | silent_mutation | Average:52.253; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1001004126 | 2.64E-06 | 2.64E-06 | mr1412 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1001004126 | NA | 1.00E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1001004126 | NA | 2.09E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1001004126 | NA | 4.99E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1001004126 | NA | 7.43E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |