Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000922521:

Variant ID: vg1000922521 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 922521
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCTTATTCAAAAAATTATGTAATTATCATTTATTTTATTGTGACTTGATTTGTCATCAAATGTTTTTTAAGTATGATATAAATATTTTTATATTTGCA[C/T]
AAAAAATTTGAATAAAACGAATGGTCAAACGTTGTTCGAAAAGTCAACGGCGTCATACATTAAAATATGGAGGGAGTAATACTTAGCAAGAACTCAAGTA

Reverse complement sequence

TACTTGAGTTCTTGCTAAGTATTACTCCCTCCATATTTTAATGTATGACGCCGTTGACTTTTCGAACAACGTTTGACCATTCGTTTTATTCAAATTTTTT[G/A]
TGCAAATATAAAAATATTTATATCATACTTAAAAAACATTTGATGACAAATCAAGTCACAATAAAATAAATGATAATTACATAATTTTTTGAATAAGACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	26.20%	0.15%	0.00%	NA
All Indica	2759	64.30%	35.60%	0.18%	0.00%	NA
All Japonica	1512	97.60%	2.40%	0.07%	0.00%	NA
Aus	269	59.90%	40.10%	0.00%	0.00%	NA
Indica I	595	53.10%	46.90%	0.00%	0.00%	NA
Indica II	465	75.50%	24.30%	0.22%	0.00%	NA
Indica III	913	64.50%	35.50%	0.00%	0.00%	NA
Indica Intermediate	786	65.80%	33.70%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.10%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000922521	C -> T	LOC_Os10g02490.1	upstream_gene_variant ; 1387.0bp to feature; MODIFIER	silent_mutation	Average:49.427; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1000922521	C -> T	LOC_Os10g02490.2	upstream_gene_variant ; 1189.0bp to feature; MODIFIER	silent_mutation	Average:49.427; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1000922521	C -> T	LOC_Os10g02500.1	downstream_gene_variant ; 3831.0bp to feature; MODIFIER	silent_mutation	Average:49.427; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1000922521	C -> T	LOC_Os10g02480-LOC_Os10g02490	intergenic_region ; MODIFIER	silent_mutation	Average:49.427; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000922521	NA	2.73E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	3.74E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	1.05E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	9.39E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	4.44E-06	NA	mr1406	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	3.23E-26	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	3.39E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	2.37E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000922521	NA	3.96E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251