Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000880358:

Variant ID: vg1000880358 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 880358
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTCCATCATCCCTTTCTCTCTCTCTCTCCCTTCTTCTCTCCACGCCTTTTCTCTTCTCTATTTGTGAGGCAACGGGCTAGCATTCACGAAGAGCTTA[T/C]
CGCTCATGGGTTGGCAAAAGAGCAAAGCCATGGTAGTGGTGGTGGCAAGGACGTGGCCAAGCTTAGCACAGCGGCAGCCACACGGATGTGGCCCTGCTCG

Reverse complement sequence

CGAGCAGGGCCACATCCGTGTGGCTGCCGCTGTGCTAAGCTTGGCCACGTCCTTGCCACCACCACTACCATGGCTTTGCTCTTTTGCCAACCCATGAGCG[A/G]
TAAGCTCTTCGTGAATGCTAGCCCGTTGCCTCACAAATAGAGAAGAGAAAAGGCGTGGAGAGAAGAAGGGAGAGAGAGAGAGAAAGGGATGATGGAATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	8.60%	0.70%	4.06%	NA
All Indica	2759	98.50%	0.20%	0.11%	1.23%	NA
All Japonica	1512	72.40%	25.80%	1.72%	0.13%	NA
Aus	269	42.80%	0.00%	1.12%	56.13%	NA
Indica I	595	98.80%	0.00%	0.17%	1.01%	NA
Indica II	465	98.90%	0.40%	0.22%	0.43%	NA
Indica III	913	99.30%	0.20%	0.00%	0.44%	NA
Indica Intermediate	786	96.90%	0.10%	0.13%	2.80%	NA
Temperate Japonica	767	49.50%	47.30%	3.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	7.90%	0.83%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	83.30%	12.20%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000880358	T -> C	LOC_Os10g02420.1	upstream_gene_variant ; 3971.0bp to feature; MODIFIER	silent_mutation	Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993	N	N	N	N
vg1000880358	T -> C	LOC_Os10g02410.1	downstream_gene_variant ; 4.0bp to feature; MODIFIER	silent_mutation	Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993	N	N	N	N
vg1000880358	T -> C	LOC_Os10g02400-LOC_Os10g02410	intergenic_region ; MODIFIER	silent_mutation	Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993	N	N	N	N
vg1000880358	T -> DEL	N	N	silent_mutation	Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000880358	NA	4.26E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	NA	1.31E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	4.01E-07	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	NA	1.88E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	1.54E-10	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	NA	6.30E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	4.16E-06	NA	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	1.07E-08	3.17E-16	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358	NA	1.59E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251